Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3903
Length(NT) : 1073
Best Gene Model Blast : Link to GSTUMT00012138001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG07383.1
Accession: ref|XP_387559.1| Score: 1228 E_value: 1e-133
KEGG Definition: hypothetical protein
Accession: fgr:FG07383.1 Score: 1228 E_value: 1e-133
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0065 Score: 811 E_value: 3e-87
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 250 E_value: 3e-22
Swissprot: P32568|SNQ2_YEAST
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction
GO:0005739 = Cellular component: mitochondrion
GO:0005886 = Cellular component: plasma membrane
GO:0008559 = Molecular function: xenobiotic-transporting ATPase activity
GO:0042493 = Biological process: response to drug
GO:0000304 = Biological process: response to singlet oxygen

Sequence:
>Contig3903
TTGGACCGGATTTTTATCGGATCATGACGGGCTTCTTCCCTGCGCTTACT
GTTGGGAAAGGACCTCCGACAAGAGAGCTCATCTGCGGCTTTACTGGCGC
TGTCCGGGATGGGGAGATGATGCTTGTCCTGGGGAAGCCAGGAGCCGGTT
GTTCAACCTTCTTGAGAGCTGTTGCGAACCAGCGGGCGTCGTTCGCAGCA
GTCGAAGGAGAGGTTCATTATGGTGGGATCCCGGCAGCGGAAGCGGCTAG
GAAATATCGAGGGGAGGTGATCTACAATGAGGAAGATGATCAGCACTTTC
CTGTTATGACAGTTTATCAAACTTTAGAGTTTGCGCTGTTAAATAAAACC
AAGAAATCAGAGAAGGAGAACATCCCTATAATAATTAACGCGCTGCTAAA
AATGTTTGGAATTTCGCATGCGGCACACACAATTGTTGGAAATGCATTCA
TTCGAGGTGTATCTGGAGGAGAGCGGAAACGAGTCTCCATTGCGGAAACA
CTCGCCACAAAGTCCGCCGTCACTTGTTGGGATAACTCGACTAGAGGCTT
GGATGCCAACACCGCGCTCGATTATGCCAAATCACTGAGGATCATGACTG
ATGTCTCCAACCGAACAACAATCGTGACCTTATACCAGGCCGGAGAGGAA
ATCTACGATCTTATGGACAAAGTACTTGTGATTGATCAGGGAAGGATGAT
TTTTTCTGGCCCCGCTACCGAAGCAAAGAAATATTTCATTGATTTAGGTT
TTCAGTGTCCTGATCGACAAACCACTGCCGATTTCCTAACAAGTATTACT
GATCGGATTGAGAGACAAATTCGGCCTGGATTTGAGGACAGGGTTCCCCG
CACCCCTGACGAGCTAGCGGCCGCTTTCCGGAACAGTCCGAACTATGCTC
ACCTCTTGGAAGATGTAGCCAATTATGAGCAAGAACTCGCTGCGACCGGA
AACACCGCCGCTACCAACTTCAAGAAATCGGTCAAATCATCCAAGTCACG
TACAGTTTGTTCTGATTCGAATCACACAGTATCATTTGTCCAGCAAGTTC
TAGCATGCACGCGCCGTGAGTAC

Sequences in the Contig:

SY0AAA52YO08FM1 SY0AAC1YA02FM1