Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3901
Length(NT) : 1957
Best Gene Model Blast : Link to GSTUMT00010464001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein CHGG_09751
Accession: ref|XP_001227678.1| Score: 159 E_value: 1e-08
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_4G08980 Score: 152 E_value: 3e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3901
TTGGAGCGCACTACTCTTTCCTGCCTATCCTTCCGGGGTCCGACCGCTCG
TACAAGTAGGAGAGCTTTTCTTCTTCTTTCGACTTCTAGGCTTTCCCGAG
AGTTTGTGAATTTGATACTTCGCCACCCTATCGAACCCGAAGACCCCCCA
ATAGCGTTCTAAATTAGCGCTTAAATTACTTGTAGCAGCGTTATTTTGGG
CAGTAGCATCCGCTTCGATGGACCACACAACTGTCCCCACGGAATCACTT
CACCAGTAGTTAGAGCACCGACGAATCTCGTACCGTCAAAAAGCCTGGGA
AGATTCCGAGAGCGTTGTGTAGGCGCCGACCTTCTTGCCCGTCCAACAGC
CAAACACCCGACCCAAATCAGTCCAGGACTCCCGATGCTGAGACAACACG
TATCTCCGAGCATGGATCCCGCCAAGACACACGGGAACTCCCATCCGATT
GGCTTTTATGCTGGAAATGGAACTGCGTCATCGAAACAACATCCCTCGCA
TGACCATCATCACAAAGAAGGTCTCTTTTTGGTCACCACATTAACCGCAC
GGGCAGACGCATGACAAGGATCAAGGCTAGGCCAAGTTTGCCAGCAAGAT
TCCGCCCTTGCTCGGGACCAACCGAAGCGGGAGCCACTGGCACTGAAAGA
GCTGACTAGTCTTTGGTTGCTGAATTGAAATGCCTTTCGCGGAAGGAAGG
CGAGTTTGCGAGTTTGCTGATGGGGCTTATTGGTTGGTGTCTAGAAGGAT
GTGAAAGAAGCACTGATGGGGTCCGAACCGCGACATTTGCTTTAGGTGCC
ATCGTTTGCCGCTTAGATATGGGCGTTGGTCAAAATGGCTGGGAGCGCGC
ATTTGGTTCGATCGTCCGTGACGAAAAGTCCCATAATGCATATTCACAAC
CAGCCACCCACAAAACTGGGCAGGATATCAGATCTCCACCCCTCTGGCAA
TGTGGTACCCGGCGCCTGCTACTCGCCAGCAATGGAGACTTGGAGAGGCC
AGAGGCTCCAATCAACAGGGCACCGTTGCCAAAAACGGGCGTCATAACTT
AACATGGTTTTGTGCTGATCGTCAATATTAGGAAAAAACTTGATTCCTCA
TAGCGCCTCCTGTCGCATTCCAACTTTCAGCGATTCCTACATAAGGTTCG
ACATGTTCCCTTCAATCCGTGTTCTGTTATGAACAGGCGGAAGTAACTTA
TCGCACCCCAGACGAAAGCGAGGAATATAAAGTGTCGAATACTATCCTCC
CGCCTTCCCCCCCCCCAAAAAAAAAGTCTCCGTTCCTTAATCGCCCACTC
TAATAGAATCTGCCCCCAAACACCGCAGTCATGTGGCCCGGAACCTTCTT
CACACTTCTTCGCATCCTGCAAATCCTCACCCTTATCCCCATATGGGGAG
TCCTAGCCTTTTTCGTCGATAAATATCCCATGGTTGAAGACGGTGCTTTC
TCTGACATCCTCTGCCTCTTTGTCGTCGCAATCCTCGCAACAATCTGGGC
AATCGCCACAATCTCACTCTTCTACCGCCGCCATGTCCCCATATGGGTCG
CGGTTATCGATCTCTGCATTTTTGGCGTTCTCATTGCTGGTGTCGTACTT
CTCGCGCCCTACGTGCGGAACACGGATTGCATCGGGGTCAACTGGGGATG
GGCATACGCGGACGGATACTGGAGCAGGGAGTGCTCCATGTATAAGGCGG
TTTATGCCTTGGGCATCATGAACATTATTATGTTCTTCCTCACTGCAGTG
TTGGCGGCGTGGATTTGGAGGAGGCATACTACTGTCGCGGTTTATCGGTA
TTAAGTTTGGTGTTTTATTATGGCTGGTTGTGGTTATGTGTGCACATTTA
ATAGTTTTGTGATACGAAAGATGTTTGGTTTTATTTTTAATGAGGGTTTT
TTGTATTTTTGTCACTTAATGAATGACTGAGAGGATGGTAGGTTTGGATG
TTTTTAT

Sequences in the Contig:

SY0AAB41YG21FM1 SY0AAC19YP12FM1 SY0AAC37YB06FM1
SY0AAC7YB06FM1 SY0AAD13YJ01FM1 SY0AAD44YO18FM1
SY0AAD4YK22FM1 SY0AAD55YA13FM1 SY0AAD57YM09FM1
SY0AAD63YA20FM1 SY0AAD9YP10FM1