Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3900
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00010281001 E-value : 8e-86
Numbers of ESTs : 4

Blast Results:

Nr Definition: actin-related protein RO7, putative
Accession: ref|XP_001263143.1| Score: 235 E_value: 3e-18
KEGG Definition: hypothetical protein ( (AF264052) actin-related protein RO7 [Neurospora crassa OR74A] )
Accession: ncr:NCU03563.1 Score: 223 E_value: 4e-17
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0679 Score: 116 E_value: 5e-07
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 118 E_value: 3e-07

Sequence:
>Contig3900
TTGGGATCCTCCTCACTGTCCCCCGGGCCATTAACCCCCTACCGTCTCCG
CCACTCCACGCACACCACAACTGCCACCACCACCATCACAACCAACCTCA
CACCCAGCAGCACCACCAGCCTCCTCCTTCCCCGTTACTCCCCATCTTCG
GCCCTACACCTACACCACTCCGAAGACCCCTTAATCTTCCAAATCGGCAC
GCGGAACCTCCAAGCCGGGTACCCAAGCGAGCCGCACCCGCGCTGCATCC
TGCCCTGGACCAATCCCGAATTCTGGAAGCGATCGGGCGACCTGTGGGGT
CTGGGGGGATGGTACTCGCCGACGGGCACCTCATCCGCTTCGCGTGGGGA
ATTATGGCACAATGTGGAGACCATCGAGGACGCACTCGAGCGGGGTGTGA
GGGTTGCGTATAACAAGTACTTATTGCTGGATTCGAAAACGCGAAGGATA
GTGTTATTGGTGAAGACGGAGGTGGACATGGGTGTGCTGAGCAAGGTCGT
CAAGAGCCTATTCGTGCACTTCCAAATGCCGGCCGTGATGTTAATGCAAG
AGCCTGTTATGGCGGTCGTTGGAGCGGGAGTCAGGAGCGGGGTGGTGCTG
GACGTGGGCTGGAATGAGGCCGTGATAAACGTAGTC

Sequences in the Contig:

SY0AAA49YH07FM1 SY0AAC19YP04FM1 SY0AAC41YH01FM1
SY0AAD52YA16FM1