Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig390
Length(NT) : 1518
Best Gene Model Blast : Link to GSTUMT00005464001 E-value : 1e-98
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig390
AGCAACTAGGCTTCGAACGCTAGAAAGGGCATTGTTGGAGAAGGCCCTCA
AGGTACTTGAGACTCAGAAAGAAAGATTGCTAGGTTCGGAGGTGGTACAG
ACCTATCTGATGCAGGTGCAGGGGAGCTCCGAAATGTCAGATGATCCTGA
AGCCCCTGACGACGAAGATGACCTTTCGTGAGGGATTATCCTAGGGCAAG
ATGGGAGGTACCACGATCAACGTGTAAGGCTTTTTTGTTTAGTACTATAA
GGACCACGGAGCGGGATGGCAGCACCGCGGTTAATATGCTCGGAAATGCA
CATCAATCCCAACGGGGGCAAGATACCATCGCTCACAAAGGCTGTCGGTC
AACAGTGATGTAAATCGTATTCCTGGATGAGGCAGAAATCGGGACTAATA
TCCAAAATTATGTTCATCTGAGATTGGTGAGCTCCACGTTTTTGCGAGGA
ACACTCCGATCATGCCATAGCCCAGACAATCTTCCTTCCTCCTTATGGCG
TCGGCAATCCCGTCCCCGTCCCCAAGAAACAGCAGAAAAGGACTGTTTCA
CGAAGATATGCCTTGGCAAGAACCTGCTGAAGCATTCAGCAAGCTATCGT
TAGAAGCCAGGCGAATGCCACCCTTCTTGATTTTTTATGGAGGATGGCTC
CGGGCATCCTACGTTTCCTATTCAGTTCGTTTAGATAGATGGATGCACAC
AATAAGGCTTTGTCGAGATAGAGATAGAGAGGGTCCTTACTGATATCAGC
AGGAATGAGCCCGTCCGGCTACGATAGGCTTAGTTTGGCAAGTTGTGAGA
ATTGCGAATACTGATTGATGAGGCCTAATATATCTAGTTGGCTGATCTTA
TACTGTGTCAGGAAAATGCTAATCCTTCTCGGGAGCCTTCGACTTTGATT
ACAGGCGGAAACAGTGGATTTTAGGAATTTTTACGGTAATTATCCCTCGA
CCGCTGACGTCTAAGCCCTATTTAAGAAGTTGGACACGAGCATATTTGAG
CAATCATGTTGCTTGTCGGAAAAACTTCGTTACTCGGAAGGGGTGTAGTG
CTCAGAGTACCGCAAAACTAGTACTGCTCAGCATGGCCATGATAGAAACG
AGCAGGTCCCTATTTGCTCCCGATTACTCAAATAGGCTAGTGTTTATCGT
TTTAAGCTGGCAGCTGAAGGGATGGCTCGGCTTCATGATCCTTCTTTCCT
TCCTCTTTGATTCACTTGGTTCCTTTATGCTTCCGAAGGCAAAGGGTCAT
GTCATATCTCGTGAGCAACAATATACACACGTTTCGAGTTTTCTTTTTTT
TCCCTCTCTCCCTAGGTCTCTTACTTTCTTACACATCACTTTTTTTCTGG
CCTTTTTTTTCCACATCTGGTCTGCCGGATTCGGGTCGCCAAGTGCGTCC
CGTCCTTGCTTGCTGGCAGGCGGGCTGTTGTGAGAAGCCGTTATCTTTCT
TTCTTTTCCTTCCTTCCTTCCTTTTTTTTTTTGATAGGCTGCTGCTGGTT
CCTGCCACTGTTGAACAT

Sequences in the Contig:

SY0AAA22YK06RM1 SY0AAA60YA16FM1 SY0AAB29YG13FM1
SY0AAC31YL16FM1 SY0AAD23YH17FM1 SY0AAD35YG06FM1