Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig39
Length(NT) : 2301
Best Gene Model Blast : Link to GSTUMT00001777001 E-value : 0.0
Numbers of ESTs : 162

Blast Results:

Nr Definition: sugar transporter family protein
Accession: ref|XP_748954.1| Score: 1522 E_value: 1e-166
KEGG Definition: sugar transporter family protein; K08178 MFS transporter, SHS family, lactate transporter
Accession: afm:AFUA_7G05550 Score: 1522 E_value: 1e-167
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 310 E_value: 1e-28
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 399 E_value: 4e-39
Swissprot: P36035|JEN1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005886 = Cellular component: plasma membrane
GO:0015129 = Molecular function: lactate transmembrane transporter activity
GO:0015727 = Biological process: lactate transport

Sequence:
>Contig39
TTGGATGTAGGGTAAAAATCTGCTTCTACTCTTCGGTTTACCCTCCGGAT
GATACTTATTGGTGTTTACTTAGCTTATCAAGCCTTTGGTCGAGTTTGGA
GGACGGTTTACGAGTAACTCATTCAACATCATACCCCAAAATGGAGCGAT
GCGCCGTCATATCTGCGTTACCTCGGACTGGTGATCTTCTCCTCAACTCT
ACGGGGGGGTACCAATATCTTCATCACCGTTGGGAACTGGTATCGTGGAT
GAGTAAACTATGAAACGGATAGCACATCTAGGCGAATACGTCACTCAATA
CGGGACCTGTTATGCTGATGGGGGCAAGCACACCTTACACTGAGCATCAG
GTGTTTAAGATACGAGTACAGTGGACTGCGAACTTATCCCGCATAACGGT
CTTGTAGCCGACTAATGTGGTAACATTTGGAGGAGGAGGAGGCCACCTTC
TTCTATCACCCTGAGTCGATTTGTTATTCTGCCCTCTACTGAAGGGTGGA
GATATCACCCTCTGTGCCAATCAAGTCAAGGCTCCACAAATCAGCGAACA
CCGTGGAGAAGGAAACCATATAAATCCAAACCCTCCCCCGTGCTGTCTTT
CATATTCACGCTTACTTCCCTTGCCCTTTGCCAACCAGTCAAAGAATAGG
AATCATGCCCCGAATGAGTGCAAGACAGTATGTGGCCACCCGCATCAGTA
CTCTCAATCCACCGGGGAACATACCCCCCAACCCGATTACCGTCCTTCGC
CAGTTGAATTGGAGACAGTGGCAATTTTTCCTAATAGGTTTCATCGGATG
GACATGGGACGCGTTCGACTTTTTCTTAGTATCTATGACTATCACGTCAC
TTGCGAAAACGTTCCATAGGTCCAAGGCCGACATCACATGGGGCATAACT
TTGGTATTGATGTTGCGAAGTGTCGGTGCCATCTCCTTCGGTATGGCTGC
AGACAAGTGGGGAAGGAAATGGCCGTTTATAGCCAATATCGTTTTGTTCA
TTATTTTGGAATTGTCAGCTAGTTTCTGTAATACCTATGAGCAATTTCTG
GGAGTTCGTTCCGTATTCGGTATTGCCATGGGGGGATTGTATGGTAATTG
CGCTTCAACCGCTCTCGAGGACGCACCCAATGAAGCTCGTGGTATACTCT
CGGGCATGCTACAACAGGGTTATTCCTTTGGTTATCTTCTAGCTACAGTA
TTCGCTCGTGCCCTTGTCAACACAACACCTCATGAATGGAGGCCCTTGTT
CTGGTTTGGGGCATGCCCTCCAGTCCTGATCATTGCTTTTCGGTTATATC
TTCCGGAGACAAATAGCTTTCTTGAACGACGGGCGATGAGGAGAGAACGT
CGCGAAGGTGTAGAAGGCATTGAAAAGACTGTCTGGAAAGAAGCCAAAGT
AGGGTTTAAGAAGCATTGGCTCCTTTTGATCTATCTTGTTCTAATGATGG
CTGGCTTCAACTTTATGTCCCATGGCTCCCAAGACCTTTATCCGACCATG
TTGGAAAACCAACTTGAATTCTCAAAAAACAAAATCACTGTTACCCAAGT
TATCGCGAACCTCGGTGCGATGCTGGGCGGAACCATAGTCGGTTACCTCT
CGCAAATGTTTGGTCGAAGGTTGAGCATAATCGTCGTCTGCACCGTCGGT
GGTGCACTTGTATACCCATACTGCTTCATCAGGAGTGATGGGGTTATCCC
CGCGGCATTCTGGATGCAATTTTGCGTGCAGGGGGCATGGGGCGTCGTCC
CAATCCACCTTCTCGAACTCTCTCCCCAAGGTGCTCGTACTACCATCGTC
GGAACAGCCTATCAACTTGGAAACCTTGCCTCCTCCGCATCATCCACCAT
CGAAGCCACTATCGGCGAGAAGTTCCCCCTTCAAGACGGACCGGGAGGTG
TCCTGCGTTACGATTACGGAAAGGTCATGGCAGTCTTCATGGGATGTGTG
TTTGTTTACCTCACTGTCCTGGTATTTGTTGGACCGGAAAATTTGGGGAG
GGACTTGACCGAGGGTGGAACTGTAAGGGAACTGGGTGGGGATTGGGACG
AGAAAGAGAAGGTAACGAAGGCTATTGACAAGGTTTAGGTGGTTATGAGA
TATGAGATGTGTATCGTTTATGAATTTCCTGGTAATTTTCTTTTATCTGG
ACTGCGAAGGAATGTGCACGGAGGGTCATATTTGTGCTTGCAAATACCAA
GGGAGTGCTATCCCTGAATTCAAAGGAGCCATCTATAAGAGCTCTTCGAG
GAAATTGATTGCAAGACTCGGCTTTGATATTTATTGATGTTTGAATTACC
T

Sequences in the Contig:

SY0AAA11YH12FM1 SY0AAA31YG04FM1 SY0AAB44YJ18FM1
SY0AAC10YC09FM1 SY0AAC11YE18FM1 SY0AAC12YF18FM1
SY0AAC13YD14FM1 SY0AAC16YE19FM1 SY0AAC16YN12FM1
SY0AAC16YO21FM1 SY0AAC18YC22FM1 SY0AAC18YH23FM1
SY0AAC18YO16FM1 SY0AAC19YH22FM1 SY0AAC1YF15FM1
SY0AAC1YM15FM1 SY0AAC1YN04FM1 SY0AAC1YO24FM1
SY0AAC20YA09FM1 SY0AAC20YC20FM1 SY0AAC20YG15FM1
SY0AAC21YJ21FM1 SY0AAC23YD17FM1 SY0AAC23YL17FM1
SY0AAC24YG21FM1 SY0AAC26YH05FM1 SY0AAC26YH05RM1
SY0AAC26YM14FM1 SY0AAC26YM18FM1 SY0AAC28YJ01FM1
SY0AAC28YL09FM1 SY0AAC28YL09RM1 SY0AAC29YI08FM1
SY0AAC30YG05FM1 SY0AAC31YA13FM1 SY0AAC31YJ21FM1
SY0AAC32YE15FM1 SY0AAC32YH11FM1 SY0AAC32YJ19RM1
SY0AAC33YM01FM1 SY0AAC35YG04FM1 SY0AAC35YL15FM1
SY0AAC36YK21FM1 SY0AAC36YN11FM1 SY0AAC38YM18FM1
SY0AAC39YB22FM1 SY0AAC39YB24FM1 SY0AAC39YF09FM1
SY0AAC3YH12FM1 SY0AAC3YO10FM1 SY0AAC40YF20FM1
SY0AAC40YG14FM1 SY0AAC40YP03FM1 SY0AAC42YA22FM1
SY0AAC42YK07FM1 SY0AAC42YP16FM1 SY0AAC43YI01FM1
SY0AAC44YH01FM1 SY0AAC45YN03FM1 SY0AAC48YG04FM1
SY0AAC49YJ05FM1 SY0AAC50YG07FM1 SY0AAC51YB06FM1
SY0AAC51YI05FM1 SY0AAC51YO05FM1 SY0AAC52YB22FM1
SY0AAC52YD03FM1 SY0AAC52YE03FM1 SY0AAC52YF19FM1
SY0AAC52YG14FM1 SY0AAC52YO14FM1 SY0AAC53YK12FM1
SY0AAC55YI23FM3 SY0AAC55YL12FM2 SY0AAC58YE15FM1
SY0AAC58YF24FM1 SY0AAC59YA20FM1 SY0AAC59YB24FM1
SY0AAC59YK13FM1 SY0AAC60YB14FM1 SY0AAC60YI09FM1
SY0AAC60YN17FM1 SY0AAC61YD24FM1 SY0AAC62YH14FM1
SY0AAC62YN08FM1 SY0AAC6YA11FM1 SY0AAC8YI02FM1
SY0AAC8YO02FM1 SY0AAC9YA13FM1 SY0AAD11YA06FM1
SY0AAD11YA08FM1 SY0AAD11YA12FM1 SY0AAD11YM06FM1
SY0AAD13YN21FM1 SY0AAD14YJ19FM1 SY0AAD14YK05FM1
SY0AAD14YK13FM1 SY0AAD15YG05FM1 SY0AAD16YB16FM1
SY0AAD16YH07FM1 SY0AAD17YJ05FM1 SY0AAD18YK10FM1
SY0AAD23YI19FM1 SY0AAD24YI23FM1 SY0AAD24YM07FM1
SY0AAD25YF05FM1 SY0AAD25YK03FM1 SY0AAD27YJ02FM1
SY0AAD29YA17FM1 SY0AAD29YD22FM1 SY0AAD29YO03FM1
SY0AAD2YB22FM1 SY0AAD2YP01FM1 SY0AAD33YI05FM1
SY0AAD33YN14FM1 SY0AAD34YB13FM1 SY0AAD34YH14FM1
SY0AAD36YF09FM1 SY0AAD36YO07FM1 SY0AAD36YO20FM1
SY0AAD38YB19FM1 SY0AAD39YB03FM1 SY0AAD39YN04FM1
SY0AAD40YC10FM1 SY0AAD41YH19FM1 SY0AAD42YK14FM1
SY0AAD42YP19FM1 SY0AAD43YE06FM1 SY0AAD44YA20FM1
SY0AAD46YK19FM1 SY0AAD46YO03FM1 SY0AAD49YE10FM1
SY0AAD50YD06FM1 SY0AAD50YI16FM1 SY0AAD50YP04FM1
SY0AAD51YA22FM1 SY0AAD51YC03FM1 SY0AAD52YI05FM1
SY0AAD53YD18FM1 SY0AAD56YA01FM1 SY0AAD56YG09FM1
SY0AAD57YK11FM1 SY0AAD57YM07FM1 SY0AAD59YE22FM1
SY0AAD59YH15FM1 SY0AAD5YB06FM1 SY0AAD5YK12FM1
SY0AAD5YP06FM1 SY0AAD60YD18FM1 SY0AAD61YA18FM1
SY0AAD62YB09FM1 SY0AAD62YM23FM1 SY0AAD63YD16FM1
SY0AAD63YH16FM1 SY0AAD6YE23FM1 SY0AAD6YH02FM1
SY0AAD6YI22FM1 SY0AAD7YJ19FM1 SY0AAD8YK01FM1
SY0AAD8YL12FM1 SY0AAD9YA06FM1 SY0AAD9YP05FM1