Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3899
Length(NT) : 998
Best Gene Model Blast : Link to GSTUMT00010777001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215371.1| Score: 908 E_value: 6e-96
KEGG Definition: uncharacterized membrane protein, predicted efflux pump
Accession: aor:AO090120000456 Score: 901 E_value: 2e-95
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1347 Score: 487 E_value: 9e-50
PFAM Definition: MatE, MatE. The MatE domain.
Pfam Number: pfam01554 Score: 268 E_value: 2e-24
Swissprot: Q10085|YAO6_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>Contig3899
TTGGGTCTGCCTGTAAAATTGCAAAAAGGGTAAATATCCCCCAGGACGAC
GGACACACAAACGTACCTGTACTGTACCTACACCATCGAACGTCGAACTG
CCGACCCCCATCTGTGGTATCTGAGCTCTCGCATCATACTTGAGCTTCAC
TCATGGATCCTACTACCACTCCTTCATCTTCATCCACCGCTACCACAAAA
ATGTCCTCCTGGCTCCCCCTCCCCCTCGGCGAGACAAACCCACTGGAAAC
GGACGAGCACACTTCCCTATTACCAAAGCCCACAAACCACGACAATGAAT
CAAGAAGCGTACTCTCAGAATTCACCCTCCTGCTCAAAAACAGCATCCCC
GTAATCATCGCCTACACGTTACAGAATTCCCTACAAACCATTTCCGTGTT
AATAGTCGGCCGCCTCTCACCCGAGCACCTCGCCACTGCTGCATTCTCTT
ACATGTTTGCCATGTCCACAGCCTGGCTGATCGCTTTAGGGGGAACAACA
GCGCTGGATACACTCTGCTCCTCATCCTACACCGGTAGTAAAAACCCCCA
CGAACTCGGCATCTTATTACAGCGTGCTTTCGTAGTGTTGGGAGTATTCT
ATATTCCAGTTGCAATCTTATGGTACTTCTCAGAGGGCGTCTTTCTGCGA
CTTGGCCAGGATCCCAGTCTCTCCGCCGATTCCGCTACCTTCCTACGGTG
CTTAATACCCGGCGGCCTGGGCTATATATATTTCGAAGCCGGGAAGAAGT
TCCTCCAGGCCCAGGGAATTATGCGCGCGGGGACTTATATCTTGCTAATC
ACGAGCCCGTTGAATGCACTGTTGAACTGGTTGTTTGTCTACCCTTTTGG
TATGGGGCTTATCGGCGCACCGATTGCGACTGGCATTACATACTGGGTGG
GGTTTTTAGGGATTATGGGGTATGCTCGGTTTTCTCGGGGGTGGACGGCT
TGGGGCGGATGGGATAGAGCGTGCTTCAGGAATATGGGTGTGTTTGCG

Sequences in the Contig:

SY0AAA22YB09FM1 SY0AAA29YF05FM1 SY0AAC19YP02FM1
SY0AAD7YJ23FM1