Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3898
Length(NT) : 1979
Best Gene Model Blast : Link to GSTUMT00001755001 E-value : 0.0
Numbers of ESTs : 26

Blast Results:

Nr Definition: hypothetical protein BC1G_06628
Accession: ref|XP_001554840.1| Score: 1910 E_value: 0.0
KEGG Definition: septin AspB
Accession: afm:AFUA_7G05370 Score: 1890 E_value: 0.0
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2655 Score: 1226 E_value: 1e-135
PFAM Definition: Septin, Septin. Members of this family include CDC3, CDC10, CDC11 and CDC12/Septin. Members of this family bind GTP. As regards the septins, these are polypeptides of 30-65kDa with three characteristic GTPase motifs (G-1, G-3 and G-4) that are similar to those of the Ras family. The G-4 motif is strictly conserved with a unique septin consensus of AKAD. Most septins are thought to have at least one coiled-coil region, which in some cases is necessary for intermolecular interactions that allow septins to polymerise to form rod-shaped complexes. In turn, these are arranged into tandem arrays to form filaments. They are multifunctional proteins, with roles in cytokinesis, sporulation, germ cell development, exocytosis and apoptosis..
Pfam Number: pfam00735 Score: 1106 E_value: 1e-121
Swissprot: O36023|SPN1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0031105 = Cellular component: septin complex
GO:0005940 = Cellular component: septin ring
GO:0005515 = Molecular function: protein binding
GO:0000920 = Biological process: cell separation during cytokinesis
GO:0008104 = Biological process: protein localization

Sequence:
>Contig3898
TTGGCTGCCTTTTTCCGATTAATCGTTGCTATCCTCCTTTCCCCCGACTT
GCACAATGTCGAAACTAACTTTTAGAGCTTCCCACAATTTAGCTGTATCC
TCTGTCGCCGCTATGTCCACTCCTTCTTTGCCAGATTCTCCTCAGCTAGA
ATCCAGATTTTCTCCATTGTCATCCCCTCTTGTGCCCGTCGCTGCTCAGT
CTACCAATCCTAAGCTTGCCGCTGCTCAGGCAGCTTCTGCTGATGCTAAG
AACATCGTGAGACGGAAGTTGACTGGGTATGTTGGGTTCGCCAATTTGCC
TAATCAATGGCATAGGAAGAGTGTCCGAAAAGGATTTAACTTTAATGTTA
TGGTTGTCGGTGAATCTGGGCTTGGAAAATCGACTCTCGTGAATACTTTG
TTCAATACCTCTCTATACCCCCCCAAGGAGCGCAGGGGACCTTCCCTCGA
CATCATCCCCAAGACCGTTTCAATTCAGTCGATCTCAGCTGATATCGAAG
AGAATGGCGTTCGTCTTCGCCTTACTGTTGTCGATACCCCAGGATTCGGT
GACTTTGTCGACAATGATGAGTCCTGGCGCCCAATCGTTGATAACATTGA
GCAACGTTTCGATGCCTATCTGGAAGCCGAGAATAAGGTTAACCGAATGA
ATATCGTTGACAACAGGGTCCATGCCTGTGTCTACTTCATTCAGCCTACC
GGACATGCTTTGAAACCCCTAGATATCGAGGTTATGCGAAGGCTTCATAC
CAAGGTCAACTTGATCCCGGTCATCGCTAAGGCGGATACCTTGACCGACG
AGGAGATTGCTGAATTCAAGAAGAGAATTCTTGCGGATATCGACCATCAC
AAGATCCAGATTTTTGAGGGACCCCGTTACGAGCTTGATGACGATGAAAC
CATTGCTGAGAACAATGAGATCATGTCAAAGGTACCGTTTGCTGTTGTCG
GTGCCAACTCCGAGGTTACCAACGCGGATGGCCGTAAAGTTCGTGGTCGT
CGCTACCCTTGGGGTATCATCGAGGTTGATAACGAGGAGCACTGCGACTT
CGTCAAGTTGCGCCAAATGTTGATTCGCACACACATGGAGGAGCTCAAGG
AGCATACCAACAACTTCCTCTACGAGAATTACCGTTCTGATAAACTCACC
GCTATGGGTGTTGCTCAGGACCCAAGTGTCTTCAAGGAGGTCAACCCTGC
TGTCAAGCAAGAGGAGGAGAGGACACTCCACGAACAGAAGCTCGCCAAGA
TGGAAACAGAAATGAAGATGGTCTTCCAACAAAAGGTTGCTGAAAAGGAG
AGCAAACTCAGACAATCCGAGCAGGAACTTTACGATCGTCACAGAGACAT
GAAGGAGCAGCTCCAGAGGCAACGGTCAGAGCTAGAAGAAAAGAAGAGCA
GGGTCGAGAGCGGAAGGCCATTGGAGGAAAAGGGGAAGAGAAAGGGGTTT
TCGCTACGTTAAAGGCCATGGAGTCGTAAAAGCGGATTTCGGATGGTGGT
GGAGTTGGGGAATAACAGCTGAAGTAATTATCCTGGAGAAGCTTGGGGAC
TACGACGTAACACTTTTGCATTTCCTTTCTCTACCTTTGGCCCGACCTTT
TACAGATTCCCATTGACATTCATTTCGATATCTTTCGTTACTCTCCTTTC
TTTCCCTTGGGCCTCTTATTATTTCTTTTTAGTACCGAATCTGAAGTCTC
TCTCTCCTATCTCCTTTATCTTTTTAAATCCAAAAATCCGTGTTCGTAGG
TATGCTTTGGACGTCCTGGTCTTATCATCTTTTTCGTTCTTATCACTTAC
TGTTTTCAATTCTGTGTACCGTGATTCTTAATCGTGAAAACGTTTTGTCG
TAAATTAGCTAGCATCCAGAGCACTAGCGGAGGGTTTCATTTTCGTTTTC
TTCTCTTTTCATTTTTAGCTTAACTGATGGGAAAAGGTGGTGGAGGGTGT
GATAATGTTGATTTTTTTTCGTCCTTGTG

Sequences in the Contig:

SY0AAA14YB11FM1 SY0AAA61YJ10FM1 SY0AAB48YC02FM1
SY0AAB6YA19FM1 SY0AAC10YO08FM1 SY0AAC19YO22FM1
SY0AAC19YO22RM1 SY0AAC21YP19FM1 SY0AAC21YP19RM1
SY0AAC26YI24FM1 SY0AAC26YI24RM1 SY0AAC28YA24RM1
SY0AAC28YH21FM1 SY0AAC31YI14FM1 SY0AAC31YI14RM1
SY0AAC38YD14FM1 SY0AAC54YD19FM1 SY0AAC57YI16FM1
SY0AAD20YI15FM1 SY0AAD2YH21FM1 SY0AAD36YE17FM1
SY0AAD3YI22FM1 SY0AAD45YC11FM1 SY0AAD50YG24FM1
SY0AAD58YB17FM1 SY0AAD7YC16FM1