Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3897
Length(NT) : 968
Best Gene Model Blast : Link to GSTUMT00003291001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein FG01306.1
Accession: ref|XP_381482.1| Score: 719 E_value: 5e-74
KEGG Definition: hypothetical protein
Accession: fgr:FG01306.1 Score: 719 E_value: 2e-74
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2887 Score: 422 E_value: 3e-42
PFAM Definition: SFT2, SFT2-like protein. This is a family of sequences derived from eukaryotic proteins. They are similar to a region of a SNARE-like protein required for traffic through the Golgi complex, SFT2 protein. This is a conserved protein with four putative transmembrane helices, thought to be involved in vesicular transport in later Golgi compartments. The members of this family also show four putative transmembrane regions..
Pfam Number: pfam07770 Score: 420 E_value: 6e-42
Swissprot: P38166|SFT2_YEAST
Gene Ontology:
GO:0000139 = Cellular component: Golgi membrane
GO:0005515 = Molecular function: protein binding
GO:0006895 = Biological process: Golgi to endosome transport

Sequence:
>Contig3897
TTGGAAAAAAAAAAAAACCAGAACAAGAGAGGGAGAAGATATCAAAAAGG
GCGCATGAGCATTTCTAACACACCCCGAGTTCAGTAAACAATCTGGGGGA
GTTTTTTTTTTCGAATTCTCCACCAGCTTCCAGGCCCAGCTGTTTATTCT
CTCAAAGAAGTCATCTACGCACCTCGCGCACCTCCCATACCAGTACCTGT
CTCTCATCCGGCCCTCTAGCTTTGTCTCCATGGCCGCCGAATCCTTCCGG
GCACAGATGAACTCTATGGGGTGGTCAAGGAGGGACGAGCCCGCTAATAC
TTCTTCTTCGTCTCCCTTCATGAATAGACTATCATCCCTGAATCCTTTTG
GTAACGGGGGGTATGTTCGGCTTCCTACGAATAGCTCCGACCCCCCTCCG
CAGCTCCCAACTCAAACTCGCCAAGAAGAGGACGCGGGATGGTTCGTATT
GAGCCGATGGGATCGTATGTTAGTATTTGCGGCTTGTAATCTGGGGGCTG
CAGCCTGCTTTGTCGTCTGCTTTTTCTTATTCCCCATACTTGCGACAAAA
CCCAGGAAATTCGCCGTGCTCTGGACTGTGGGATCGATACTGTTCCTGAC
CTCCTTCGCGGTTCTCCAGGGACCACTCGCCTACGCGACGCACCTTCTTT
CGACCCCAAGACTACCATTCACCGCAGCATATTTTGGAAGTATAGCTCTG
ACTCTATATTTTGCACTTGGGGTACAATCTCTTTTCCTCACTCTGATCTC
CTCGATAATCCAACTTCTGGCTTTGGTGTGGTATCTCATATCGTATTTCC
CTATGGGATCATCAGGCCTGAGATTCGCGAGCCAACTAGGGGCTAGACGA
GCTGCAGCATGGATGCAGGGCTAAGGCTTGAAAGGCTCAGATCATTTGTC
GTGTGAATCAAAACAAGATCCCACAGGTCTCCCTAAGACATCTGTCTGTT
CACATGGTGGATATTTGG

Sequences in the Contig:

SY0AAA47YC10FM1 SY0AAB18YE20FM1 SY0AAB49YK03FM1
SY0AAB9YM05FM1 SY0AAC19YO10FM1 SY0AAC19YO10RM1