Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3895
Length(NT) : 3493
Best Gene Model Blast : Link to GSTUMT00004655001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein BC1G_07180
Accession: ref|XP_001554591.1| Score: 2903 E_value: 0.0
KEGG Definition: acetylglutamate kinase, putative [EC:1.2.1.38]; K00145 N-acetyl-gamma-glutamyl-phosphate reductase
Accession: afm:AFUA_6G02910 Score: 2897 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG4354 Score: 1156 E_value: 1e-126
PFAM Definition: DUF619, Protein of unknown function (DUF619). This region of unknown function is found at the C-terminus of Neurospora crassa acetylglutamate synthase (amino-acid acetyltransferase, EC: 2.3.1.1). It is also found C-terminal to the amino acid kinase region (pfam00696) in some fungal acetylglutamate kinase enzymes..
Pfam Number: pfam04768 Score: 370 E_value: 1e-35
Swissprot: P54898|ARG56_NEUCR

Sequence:
>Contig3895
TTGGGAGAATGGATCCTTGTATTATTATTTTTTTTCGATGATGTTTCCTT
GAATTGCTCAATTCCTATTTTCCCTGAAACCTCTCTTTTGCCTCTTTCCT
CCTACCGTACCCTTGGTAATAGTCCTTCCATCGTCTTTATCGCTGTCGAG
CTGTTTCTCCGGGGCCCTCTGACCCGCTTAGAGCTGACACAACCTCAATC
CAGCGGTCTTGCCCGGCCGTATAAGTGCGGCTCATTTCGAACTGTGAACT
CATCCTTCGGTTTGCTCGCGAGGACATCTGGCAACGTCTCTCTCTTTTTT
CTTTCCTTTTTCTCCCCCTCTTTTCGTTGATAACCCTTTTCCTTTCCGTG
CTGCTGCCACTCTGCATTTCCCTCTCATTCATTGCTTCCAACAGTTATGT
TGTCTGGGCTCCGCAACTCATCTAGGCGGTCCGTTCGCCTACCGACTTTT
AGGAACTTGCGTGTGATTCGCCCCGCTGCCCCAATTCCCTCAAGTTCTTC
GACCTGCCCACTCCGCATAACTGCTTCGTCATACGCTACCACCAGCCTCT
CCCCATCGCCGTTATCCACTCGGTCCACCGTTATCCAACTGCTAAATAAC
ATTGGGTCCAAGAGGGAGGTGGAGCAGTACCTGTCACACTTCACATCTGT
TCAGTCCCAGCAATTTGCCGTCATTAAGGTGGGCGGGGCGATCATTACGG
AGCACTTGGATTCGTTGTCAAATTCGTTGTCCTTCCTTAACCATGTCGGA
TTGTTTCCCGTCGTCGTTCACGGCGCTGGCCCACAGCTTAACAAGATGCT
AGAGGCAGCAGGTGTGGAACCCCAATTCGAGGATGGGATCAGGGTCACGG
ATGGAAAGACCCTTGCCCTGGCAAGACAATTGTTCCTGGACGAGAACTTG
AAGCTTGTCGAAGCCTTGGAGAAGCTCGGGGTTCGGGCCAGGCCCATCAC
CGGCGGTGTTTTCCAAGCCGACTACCTAGACCGCAAGAAGTACGACCTCG
TGGGAAAGATCACAAGCGTCGATAAACGTCCCATTGAGGCCGCTATCAAG
GCGGGGTGTCTTCCGATTTTGACGTCAACGGCGGAAACTGCTGAGGGGCA
GCTGTTGAACGTCAATGCGGATATTGCTGCTGGTGAACTCGCACGGGCCC
TCCAGCCCTTGAAGATCGTGTACTTGTCCGAGAAGGGTGGTCTATTCAAT
GGCGAAACTAATGAAAAGATTTCCACCATCAATTTGGACGAGGAGTACGC
TGGCTTGATGGAGCAGTGGTGGTGCCGGTTTGGGACGAGGTTGAAGATCA
AGGAGATCAAGGAGTTGTTGGATGGACTGCCCAGGACTTCCAGCGTTGCT
ATTATTGCTACCGAAGATCTCCAGAAGGAGCTCTTCACAGATACCGGCGC
CGGGACTCTCATAAGGAGAGGTAACAAACTTACCGCCATGTCTAGTATTG
AAGGATTCGAAGATAGAACACGGCTGGAAGAGGTTTTGGGCAGAGAGAAG
AACGACGTTTCGGAATATTTGAGCTTTTTACAGACAACTAAATTCAAGGC
GTACGCTGATGAGCCCCTCGAGGTTCTGGCAATTGTCCTTCCGAGTGAGA
GTACCAACGAGCCTGCGAGGCTGGATTTCTTCTCGTCGACTAAAGCTGGG
TGGTTGGGCAACGTGGCTGATAATGTCTTCAACTTAATCAAGAAGGAGTA
CCCCAGGTTGGTTTGGTCTGTTAGGCAGGGTGACGGACAGTTGGGCTGGC
ATTTCGACAAGTCTCAGGGAAGCTTCAACCATGGGGGCCAAGTTCACTTC
TGGTACGGATATGAGGGACCCGAAGAAGTTAAGTCATTGATTGGGGGCTT
CTTGGCTGATGCCGGTAGCCGCGAGTCTGGAAAGTCTGAAGGAGCTGTCA
CTGGTGTCAAGCAACAGGTTAGGGGTTTCTCGGCGTCTGCGGGGCCGGGC
TCGCGATGGGCTGCTTCTATGGGATCTGTTCTTCGTCACCCGCGACGAGG
ATTTGCCTCTACAAACCCGAACCCACCCTTAGGCTCAAGTAACGCGACCA
ACAACAAGCCTTCCAAGGTAGCGCTTATTGGCGCTAGAGGTTACACCGGA
CAAGCTTTGATAACTCTCATCAATTCTCACCCACATTTCGATCTTACCCA
TGTTTCATCTCGAGAGCTGGCTGGAAAGAAGCTTGAGGGATATACCAAGG
ATGGGAAGGAAATCGTCTACCAGAACTTGGGTGTTGAGGATATCAGGAGG
ATGGAGGAGAACGGTGAGGTTGACTGCTGGGTTATGGCTCTCCCCAATGG
CGTTTGCAAACCATTTGTAGATGCTGTTGAGGATGTTGGAAAGGGCAAGA
GCGTGATTGTCGACTTGAGTGCCGACTTTAGGTTTGACAGCAAATGGACT
TATGGATTGCCTGAGCTTGTGCCCAGAGAGACCTTGACCAAGGCTTCTCG
TATCTCCAACCCCGGGTGTTACGCTACCGCAGCTCAGATTGCTATTGCAC
CTTTAGTACCATACCTCACCGATTCTCCTACCATATTTGGTGTATCTGGT
TATTCTGGGGCTGGAACAAAGCCAAGTCCTAAGAATGACGTCGATCAGTT
GAGGGATAACTTGATGCCTTACAGCTTGACCGATCATATCCACGAACATG
AAATCGAAGCTCGACTTGGCGTCCCGGTTGCTTTCATTCCTCATGTCGCA
GTTTGGTTCCAGGGGATTCATCACACTGTTAGCGTTCCGTTGGCCAAGGA
GATGACTTCTCGTGAGATTAGGAATTTGTACCAGGATAGATACGCCGGGG
AGAAGCTCATCAAGGTTACTGGGGAGGCTCCTCTTGTCAAGAACATTTCT
GGCAAGCATGGCGTGGAAGTCGGTGGCTTCGGCGTCCACTCCTCCGGTAA
GAGAGTAGTTGTCTGCGCAACTATTGACAATTTGCTTAAGGGAGCTGCCA
CACAATGTCTTCAGAACATGAACTTGGCTCTCGGGTATGGCGAGTACGAT
GGCATCCCTTTGGGCTAAGCGGGGTTTTGGTTTGGGAGAAGGATTTCGGG
CTGGCGGTGGAGTTTGACTAGTTCTTTTCTCCTTTGGACTATCATATCTT
TTTTTCTTTCCCTTCCTCTCTTGCTCTCTAGTTTAACTTCGTATTTCTAG
GTTTGTGTGTCGCTTTTTGCGAAATAAAAAAAGCGCTTTTTTTCGGTTTA
GGGTTGAGAGGCACTGTCAGTGGATTTGCGGATTGGTTGGTTGGTTGTAT
ATATATACCATAAATCGGGGGTTTAACTTATCGTATTATACAAGTATGGT
ACTAGGGAGGTTGAAATGGTGGCTTTGGGGGTATATTAGATAGTTGGACC
ATTTGGTGAGCTTTGATGGTGACGTTGGGGGTAGGATGAGAGTGGTGGCT
TCCTATTTGCGCTGCTCCTCAGCCTTGTATTTTGCGGGATGAGTTTGGGT
GTTGGGCACCTTGATTTTTATCGATTTAGTTGGGATGCTACTG

Sequences in the Contig:

SY0AAA18YP17RM1 SY0AAA53YL22FM1 SY0AAB10YB23FM1
SY0AAC19YN20FM1 SY0AAC19YN20RM1 SY0AAC34YG16FM1
SY0AAC36YK24FM1 SY0AAC37YJ07FM1 SY0AAC38YA18FM1
SY0AAC56YO19FM1 SY0AAC8YE10FM1 SY0AAD1YD21FM1
SY0AAD24YG21FM1 SY0AAD57YI19FM1 SY0AAD6YK08FM1
SY0AAD9YD15FM1