Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3894
Length(NT) : 1027
Best Gene Model Blast : Link to GSTUMT00000919001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_13165
Accession: ref|XP_001803377.1| Score: 183 E_value: 7e-12
KEGG Definition: hypothetical protein
Accession: ncr:NCU04014.1 Score: 177 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3894
TTGGTGAGCTCCCACACCTCCCCGCCCTCTCGCCCAGCTCCCGGTCCCCC
TGCAATGCGTGTATATCCCCATGTTCATGACCTTGTGGCTCGCACTGCTG
GTCTCCGACCAAGCGATCGTTCGATTAAGGCATGGCTCGAGGCTGCTGTT
CAATCTTGGCACTGTGCCAGGGCTCATCTGATTTTTAAACGTCAAGATGA
AGCATACGTTGAATATCTTCTTGCATTTGAAATTGCGGCCGATATTATTC
CGAGATGCCAGGATTTTCCCACTTTCAAAACCACGGCCGGTCGTCTTTAC
CAGGACTTTGAAACTTTGAAAAAGGAGTTGGTGCAAAAAATTCCCCAGTT
TGCCAAGGTTAAAGAGGAAATCAAGAAAAATAACGATATCTCCGGAGTTG
TCAGTGCCCAAGCTCAACTAGAAGCAGAGGCGCAGTTGCGTGCAGCAAAG
TCTTCATCTGACAATCGCGGAAATGCAGCTACCGGATCGAAGAAGCCTGT
AGTGAAAGCCAAGCCCGAAATTTTGTCCTCTAGGCCACTCCTAGATTTGC
AAGGTATGGTGGCTTCACACAAGAGCAACGGGACAGGAGGTTCCAGCTCG
AAAACCGGGAAAGCTGCTTCGGATGACTTGGATTTGGAGGCTCGATTCGA
CAAGCTTTCCACGCCATCTGGCCGGCCATCTTTGCTTTCAGGTTCCCAGC
GCAATAGACAGCCGGCATCTGCAAACCTCCAAGATCCAAGGGAGGTGCAT
GCGAAACTGCCACCGCTAGATGTCAGTGCGATGCGCAAACTTCCAGCTCC
AACATATTCACCGGCAACCAGTTTCACATCTCCCACCGGGATACCACCAC
ATCGAAGTTCTACTCGTCCCTCCCTGCCCACCCAGGCTCCAACCGAGTCG
GAGAGCGCTCGACCACGGCCCACGGCCCCCAAGGTGACCACTATCTCAGT
CGATACACTTTGTAATTATCTCCAGGAACCAGAAATATCTGTACTACTGC
TTGACGTCCGTCCTCGAAGTAAATTTA

Sequences in the Contig:

SY0AAA36YH10FM1 SY0AAC19YN16FM1