Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3893
Length(NT) : 398
Best Gene Model Blast : Link to GSTUMT00009396001 E-value : 4e-77
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001244143.1| Score: 161 E_value: 5e-10
KEGG Definition: acetolactate synthase, large subunit, putative [EC:2.2.1.6]; K01652 acetolactate synthase large subunit
Accession: afm:AFUA_3G10310 Score: 156 E_value: 9e-10
KOG Definition:
Classification: [Amino acid transport and metabolism, Coenzyme transport and metabolism].
Kog Number: KOG4166 Score: 123 E_value: 3e-08
PFAM Definition: No Hit Found

Sequence:
>Contig3893
GCGCCTGGGTAACGCCCTTTCTCTATTCATAAAATAATTGGAATGAACAA
GAAGACACATAAACATAAAATATTCAAATAGCCGTTTTAAAACCCCCTAA
AAAATAGCCAAAAGAGCCGTGATTGGATCTCTTCACCCATTTTTCCGCAA
CCCGAAAGAGGAAAGGAAAAGAAAAGAAATACAAGCTAGAAATCGCTAGA
ACATTACAAATCAAAGGACCCAAGGAAATTTCTATTGGTTCAATATGCCG
CTAATATTTTCCGTCTGGGAACCGGGCTTGCAAAGCTGCCTTGCGTTGTT
TCTCCCTATCCGGGTCATAAGCCAGGAATTCGTGGAGGGCTTTGCCGGCT
GGCACCATTGGCAAGACAGGAACCTTCTTGTCCACAACGACCTCCAAG

Sequences in the Contig:

SY0AAC19YM16RM1 SY0AAC20YD02RM1