Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3892
Length(NT) : 755
Best Gene Model Blast : Link to GSTUMT00007715001 E-value : 1e-111
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3892
TTGGTACCCCCCGCCCTCTTATTACTTCACATTCATTCACTCACTCACTC
ACTCACTCACTCACTGCGTCCTTCTCTTATCTGCAACGATTAGAAATACA
CGTTGTGCCCCTCTCTCTTCCCCGCGACCACCACTCTCCCGCAAGCCCTA
ACGCACAGTACCGCATCTCTAGAAGGAAGATCTACATTACAACGAAGTCA
AATCTACTTTCCGAAGCTTCCATTCATTTTTGAATAACCCGCTACCATGG
CCCACCATCAACATTTCCACACTCGGGCGGAGAAGGAATCTCAAGGATTA
TGGAGCTTATCCCAGCAGATCAACGCAGCCACACGGTTTGTTTCTTTGTT
CTCGAAATGTATTCTGATCATGTAATGATTTTCTAACTGGAGGGTGCAGT
GAGGGACATGATAGGGTTAATGTTATGATCATGAATAGACTTTCTTTAGG
TCTTAGAGGTCTGTCTTTCTTTTTTTTCGCCCTTCTTTTCCAACCACAAT
TATCATACCTGACAAGCACTCCACCGGATGCAGTGCGTGTGCTGATGCTA
TACAGACTACAAGCTCTACCGTGAGGGCATCTTCTCATTCTGCCAAGTCT
ACCGGGCTTTTGAAGACGCCTGGATGGCCGCAATCTCGTCCGAAGCTACC
ACTGATCCCAGAATCAAGACCGCGTTGCAGAATCTCTACTCGCTGCCTCT
GTTGCGGGCACCCCAGCTGTTCAAGGACCTGGAATACTTTTCCGACCAGG
AAACC

Sequences in the Contig:

SY0AAC19YM09FM1 SY0AAD11YL12FM1 SY0AAD1YB16FM1
SY0AAD28YG08FM1