Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3891
Length(NT) : 1051
Best Gene Model Blast : Link to GSTUMT00008667001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_03141
Accession: ref|XP_001558109.1| Score: 714 E_value: 2e-73
KEGG Definition: hypothetical protein
Accession: ang:An14g00750 Score: 696 E_value: 1e-71
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2760 Score: 137 E_value: 4e-09
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 111 E_value: 4e-06
Swissprot: Q06696|VPS36_YEAST
Gene Ontology:
GO:0000814 = Cellular component: ESCRT II complex
GO:0005515 = Molecular function: protein binding
GO:0016299 = Molecular function: regulator of G-protein signaling activity
GO:0000433 = Biological process: negative regulation of transcription from RNA polymerase II promoter by glucose
GO:0045053 = Biological process: protein retention in Golgi
GO:0006623 = Biological process: protein targeting to vacuole
GO:0000723 = Biological process: telomere maintenance
GO:0043162 = Biological process: ubiquitin-dependent protein catabolic process via the multivesicular body pathway

Sequence:
>Contig3891
TTGGCCATCAGCGATATTTTTATTTTATTTTCTCTCTCACTCTCCCTCCC
TCATCGACGTGCTCCGTGGCATGATATGACATGCTTTCCCAAATCCACTT
GACTCCCGCATCTCGCCCTCTCCTACTCCCTGACGAGACATTGTTATTCG
TGCAGAACGCGGTCGGGCTTTACGAAGGGAAATATAAAATCCCGAATTAT
CAGAATGGTAGTGCGTACTTGACGTCGCATCGGGCTTGCTATGTTGATAA
TGAGGATCCGAGAAAGTTCTCGGCGGCGGTGGAACTTAAAGATGTTGATC
GGGTGGAGTACTACACCGGGTTCTTGAAATCTTCGCCCAAGATCACACTG
CTTCTTAAGCCCCCCATTGCCACCACCAACGTCGCTGCTGCGAGCAACTT
TACGTCCTCGCCGGGGAATAGGTCTGCAGTGTCGACGCCCAAGCCCGCTA
CCCCGCTCATCAGACCGACGTCCCCGTTGCCGGCTTCGACGGGAGTTTGG
ATATGCCCTATATGTTCGTTCTCGAACCCCATCCCGTCGAACTACATCCC
GCAGGTGACTCCCGCAGCGTCCATCCCCCCTTGTCTAGCCTGCGGGATCA
GGCCATCCCCGGAGGTACTGGAGAGCTCGTCGCAGCAGCCGCCACCGAGG
TCACCGACGCCCTTGTCGTCACTGTCGCCGCTGCATCCCGCCGGGAGCGA
GCTGACCCCGAGCCCGGCTACTGCCGCTACTACGACCGCCCTAGGCGACA
GCGACGAAGCCACGTTTGCCTGTCCGAGATGCACGTTCTTGAATCACCGC
TGGCTGCGTTCCTGCGAGATCTGCGGTGAGCGCTTGATAAGCCCAGACAT
CCCCGCTGAACAGCTGCTAGAAATCACGCGCGGGGAGTCGCCCGCTCCAA
CCTCGATATCCTTCAAGGGTGGGCTGGTCGGGGAGAGCGTAGAAGTGGTG
AAATTCTCGTTCCGCGCCGGCGGGGATAGAGTCTTCCACGAGCGGCTCAA
GAATGCCCTGATACAGCGGAAGTGGCTGCTGCAGAATGCCCCGCCGGTGC
C

Sequences in the Contig:

SY0AAB55YD24FM1 SY0AAB60YK02FM1 SY0AAC19YM04FM1
SY0AAC30YE18FM1 SY0AAD21YO02FM1