Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3890
Length(NT) : 936
Best Gene Model Blast : Link to GSTUMT00006254001 E-value : 1e-146
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001588093.1| Score: 234 E_value: 8e-18
KEGG Definition: hypothetical protein
Accession: ncr:NCU03986.1 Score: 205 E_value: 9e-15
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0261 Score: 226 E_value: 1e-19
PFAM Definition: RNA_pol_Rpb1_1, RNA polymerase Rpb1, domain 1. RNA polymerases catalyse the DNA dependent polymerisation of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). This domain, domain 1, represents the clamp domain, which a mobile domain involved in positioning the DNA, maintenance of the transcription bubble and positioning of the nascent RNA strand..
Pfam Number: pfam04997 Score: 188 E_value: 4e-15
Swissprot: O94666|RPC1_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig3890
TTGGGCCACTCTCGCAACTCGAGAATCTCGCAACACCGGAGCAGACGTTA
GCTACTTCTTCCATTTTTGCCGAACAGACCCTTAGTAAGTTGAGGGGATA
CAGGCAAAGAAGACTGCCTTTGTGGATTTCACGAGGTCCTACAGCCCGGT
TGAAAATTATCTCTTGTCAGCCTCATGCAAGAAATTATACGACTCCGGAG
TGCATATGGAACGTCTGGCAGGGAGCTTAAAACTAGCCCCAGGAGTCTCT
TTACGGCCTCAAACTACCGGTACCATTTCAAGGCAATTTGGAGCATCATT
CTTTGATCAGTCGAGTGAAAAGACATGTTAGTATAGGGGTTGGGTTTGCA
TTACCGTAGTTACCCGGTCATGCGTTCGTGAGGCCAGGGTTTCAATATCT
AAAGTCTAGAGCAACCTTTCTCGCAATTGACAAAACCCTTCAAATAATCC
CTACAGACTCCCCACTTACCTCCCACCCCTTCATGCTTTGTTCTCTCTCG
TAGGTCCTAAGGCCCATGTTTCTTCGGCAGCAGATCAAATTTCTTAAGTT
ACTAAGACTACCCAGTATTTCCCCTTGATTTACAATTAATTGTATTAACA
TTAGGCAGTTCTTCAATCCATTTTTGTCAAAGTTTCTCGAGCGCCGCCAG
CAGCCAATACGCAACCTTCGCACGCAATGCTGTCTACCGCAACGAGGGAG
GGAATGAAGGAGCAGGTGGTGGATAACCTGCCGAAGAGGATAAAGGAGGT
GAAGTTCGGGATTATGTCGCCACAAGATGTAGTAAAGCAAGGTGTCATAG
AGGTCGCCAAGAGAGAGTTGTTCGATCTGGAAGGTGGTGGGAGAAAGCCG
AGGCAGAATGGTGCGCTGGATCCCAGAATGGGGACGTCCTTGAAGTCTGG
GGTTTGCGAGACTTGCGGCGAAGGTCTTACGAACTG

Sequences in the Contig:

SY0AAC19YL02FM1 SY0AAC19YL02RM1 SY0AAD36YJ08FM1