Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig389
Length(NT) : 748
Best Gene Model Blast : Link to GSTUMT00000066001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein FG06855.1
Accession: ref|XP_387031.1| Score: 296 E_value: 3e-25
KEGG Definition: hypothetical protein
Accession: fgr:FG06855.1 Score: 296 E_value: 2e-25
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0533 Score: 199 E_value: 1e-16
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 157 E_value: 1e-11
Swissprot: O08583|THOC4_MOUSE
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0003723 = Molecular function: RNA binding
GO:0003697 = Molecular function: single-stranded DNA binding

Sequence:
>Contig389
TTGGTATCTGCTTAGTTTTGCCGTTCAGCCTTTCCTACACTTTTCGCCTT
TCCTTCCATAGACGTCATGGACAAAGCTCTTGACGATGTGGTTCGTGAAC
GATCGCATGACAAGCGCAGCAGCAGTAGTAGTAATGACAGAAGGTCCCGC
CGTAACCCCCGAGGCGGTGTCAGAAAGACTGGCCGCCGCGATAACACCTA
CAATGATTCACTCGCTTGGGTTCATGACAAGTACGATGGGGATCTTGGTT
TAGCGACTAATGAACCATTGCGGCGGGCCGCGGGCTCGGATATGCGCCAC
AATTCTGACACGGCAACGCTCGTTGGTGCCGGCAAGTTGAGGGTCGAGAA
TATCCATTATGAACTTGGAGAAGAGGAACTTCTTGGTCTTTTTGAACGTC
AAGGCGTTGTTCTAAAGCTCGAACTCAAATACGATCGTGCGGGCCGCTCT
GAGGGCATAGCTTTCGTCACCTACGAGCGCGAGGCTGACGCAAAACGTGC
AATTGCCGAATTTGACGGCGCAAATGCCAATGGACAACCAATCCACCTCA
CCTTGGTCCACCACCACCACCAAAACGAGGGGAAATCCCTCTTCGATCGC
ATCCGTGCTCCAGACCCCTCCGCTCCACTCTCGACTGGTGCGGCCTCGTC
CGCCCGCGACCGGGCCCGCCGCTACACTGACTCCCCAGAGAGAGACTCCC
GCCGCGATCCTACCCGCCGTCCCACACCACCAAACATTGACCGCTATG

Sequences in the Contig:

SY0AAA22YJ18FM1 SY0AAB60YK10FM1 SY0AAC59YN10FM1
SY0AAD45YI12FM1