Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3888
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00005530001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_09474
Accession: ref|XP_001799766.1| Score: 128 E_value: 7e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: ODC_AZ, Ornithine decarboxylase antizyme. This family consists of ornithine decarboxylase antizyme proteins. The polyamine biosynthetic enzyme ornithine decarboxylase (ODC) is degraded by the 26 S proteasome via a ubiquitin-independent pathway. Its degradation is greatly accelerated by association with the polyamine-induced regulatory protein antizyme 1 (AZ1)..
Pfam Number: pfam02100 Score: 125 E_value: 5e-08

Sequence:
>Contig3888
CACGTATATCCACGCTTTCAGACTTTATTTTCATAATATTATCACAACGC
AATCAAATTTTGGGTTGGACCAAAGGGAAAAAAAAGGAATAGATAAAAAT
TTCCCCGATGCAAGTAATTCTCAAAACGACCATCCCAATCATAACGAAAA
CCGAACCTTTTGTGTGAAGAGAACAAGAAAGAAGGGAAAAGGGAAAAAAA
ACAGCAACGAAAAAAAGACTCAAGAACCAAACGAATGGAGTGAAATAATA
AAGTAGCCTCTGTATCACGCTTCCAAGGAAAGTCGCGGGAAAAATCCCTT
TACAATTCCATACCGACAAAGATCCACCGATCGCTTGTTACTTCTTCATC
TACTACCGATGAGGTGGTTGACGAAACGCTGGAAAAGCTGCCACTGCGGG
CGTTGGTTGAGGAGTAACTTGACGGCGGTGTAGGAGGGAAAACGATTGGG
GCCATTGCCTGAGGACTTGGAGTGCTATCCAGCTGTAACCAATGAGAAAG
GGTGATGAGCTCGAAACCAACCCATCCAAGATCGCGGATAAGTGAATGAA
TCCTATCCGTCTTGCGATCCAAGCAAATAACCAGACGATCACAGCTGAAA
CATTCGCTGGCCAATTCGATAAGAGCCAA

Sequences in the Contig:

SY0AAB10YJ23FM1 SY0AAC19YI24RM1