Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3887
Length(NT) : 483
Best Gene Model Blast : Link to GSTUMT00011415001 E-value : 1e-50
Numbers of ESTs : 4

Blast Results:

Nr Definition: adenosylhomocysteinase
Accession: ref|XP_359622.1| Score: 109 E_value: 1e-10
KEGG Definition: adenosylhomocysteinase [EC:3.3.1.1]; K01251 adenosylhomocysteinase
Accession: mgr:MGG_05155 Score: 109 E_value: 6e-11
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1370 Score: 113 E_value: 8e-07
PFAM Definition: AdoHcyase, S-adenosyl-L-homocysteine hydrolase..
Pfam Number: pfam05221 Score: 111 E_value: 1e-06
Swissprot: Q01VU1|SAHH_SOLUE
Gene Ontology:
GO:0004013 = Molecular function: adenosylhomocysteinase activity
GO:0006730 = Biological process: one-carbon compound metabolic process

Sequence:
>Contig3887
ACACCAAGAATCTAGTGATATTTATTTCACCCTACTGGTAACTGTTGAAG
ACCAAGTACGCCCCATCCCTTGCATGAACCATAATAAACAGAAGAAACCC
ATAAAATGGAAGGGAAAAAAAGCAATTTTCACAATTTTATTTTGGAAAAC
CCAACACGTAAGGAATGCCGTTGAGGACAGACAGGTACGTTTTCATCAAA
ACTGGACTCTCAAGACGTTTGTTTTTACAAAGTTTAGTAGCGGTAGATGT
CAGACTTGTATGGTCCCTCGGGCGAGAGACTGAGATACTCGGACTGCTTA
GGAGTCAAAGTCTCAAGTTTGACGTTCAAGCTATGGGAATTATTAATCGC
TCTAGTGCCATGGAAAATTTCAGGAGTACTTACTGAGACAGATGAAGACG
AGCGACTTCCTCATCAAGAATCTTGGGGAGGGTGTAGACACCAACCTCAA
GCTTGCCGGCAGCCTTACCGAACTCGGGGTACT

Sequences in the Contig:

SY0AAC19YI21RM1 SY0AAC20YK06RM1 SY0AAC28YN14RM1
SY0AAC32YG12RM1