Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3885
Length(NT) : 745
Best Gene Model Blast : Link to GSTUMT00007324001 E-value : 1e-133
Numbers of ESTs : 3

Blast Results:

Nr Definition: TPA_exp: CaaX farnesyltransferase beta subunit
Accession: tpg|DAA01791.1| Score: 279 E_value: 3e-23
KEGG Definition: hypothetical protein [EC:2.5.1.58]; K05954
Accession: ani:AN2002.2 Score: 279 E_value: 2e-23
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0365 Score: 180 E_value: 3e-14
PFAM Definition: No Hit Found
Swissprot: O13782|PFTB_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005965 = Cellular component: protein farnesyltransferase complex
GO:0008270 = Molecular function: zinc ion binding
GO:0006995 = Biological process: cellular response to nitrogen starvation
GO:0009935 = Biological process: nutrient import
GO:0018347 = Biological process: protein amino acid farnesylation

Sequence:
>Contig3885
GGAAGAATTTTTAATGTAAAGGTGATTGCCATACTCCCTGTGGGAAAAAG
AATGAAGAGAGAAGGGTTGTTCGCGAACATAAATTCACGCAAAGGAAAAA
CGAAACTTAAGTTAACCACACACTCCGCCAGCTGCTGCGGAATCAAAAGC
TAGCAAAAGACGCGGAATTCCTCCCGTTCCTTGACAAAAGCATTAAAATC
CCACCTTCCCCTTCCACCATGCTTCTATCTCCCCCGCCCTTTCAAACGGA
ATATTGAAAATCGGGTGGTGCACCTTCAACCTATCGCTCTCCACTTCCTG
TCCGGGTAACAGGTCCTCCTCGGTAACGTCATCTGGCCACGCTGGCATAT
CCTTGACGATTGCTTCCGCCACGTTCGGGGTATTGCTGGGTATGCGTGGG
GAGTAGCGCCATAGGAATGGGGCTGTGAGTGGGAGGGGGGGATCTCCGGA
TCCGCGGTTTGGGGAGGGCGGGGGAGAAGAGAGGGGGATGGGGGAGGAGG
TATAGTAGAAGTAGTTCTGTGTGCTGGCGAGGCCGAGGAGGATGTAATTT
GAGTGATAGTAGTCTGGACCTTTCCTAGGTTTGTCACGAAGGCCACCCTT
TGGGCTTTGACAGCAGTTCATAATATACCGTGCCAGCCCCTCCCTGCTCC
AGAGACTTCCAACAACCTCCTTCTCCCCTAGTTTTTCCTCGTTTTCATCC
TGCGGGCCGTTAATACCCGCTTCGATCAACGCCCAGCACCCCCAA

Sequences in the Contig:

SY0AAC19YH08RM1 SY0AAC19YL14RM1 SY0AAD48YM01FM1