Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3883
Length(NT) : 748
Best Gene Model Blast : Link to GSTUMT00001499001 E-value : 1e-159
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 240 E_value: 3e-21
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 209 E_value: 1e-17

Sequence:
>Contig3883
CACAAACTTAAAATACAATACGATTAGTAAGAGAAAGGGAAGAGAAAAAG
CCAGACCGAAACTCCACCTCCATTCCGACCCGTTAGAACATAACATGATA
AGGAAAAATGCGTCTTTTATTCACGTTCTTACCTACCTGTCTCCGCCCCA
TCCAGTGTATTTTTTTTGCCTCTTGGAACGAAAAGAAAAGGAAAAAATGG
AAATATTGGGAAATGCGGTATGGGCTAAAATGGGAAACAAAAGGTGAAAA
AGTGAGGTATGCAAAAAAAAAAGTAAAAAAAGTAGAAGAAATAGAAATTG
TACATTTAGCACATTCAAACAGGACATGTGGTAATAGAGTTGGCGAGGAC
AATCCGTCTCTAACGACGTCCCTTCTTAGACCCGTACCGCCCAGCAGTCC
ACATCAGCAATGGCGGAATACTCGGAACAGGCTTCGGGCGAGGAGGTTCC
GGCGCGACAGCGAGCACCTGAGGTAGTGGAGGCGGGTGATGGTACGCCGG
CTCCGGCGCAGCTTCTCTAATCTCTGGAGCTGGCTCAACAACAACTACCT
CAACCGCAGGCGGTGGTGGAGGGGCAGGTGGAGGTGCAGGTGCGAGCGCA
GGTGCGGGCTCGGGCTCAGCAGGTGGTGGTGGTGGCGGTGGAGGAGTTGG
CGCCCGCACAGGGGTAGGCTCAGGAGCTGGTGCTGGTTCTGGCTCGACTG
GCGCGGGTGGGGGAGGGGGAGGCGCCGGCGGTTCCGGCTCCGGTCCAA

Sequences in the Contig:

SY0AAA35YI11FM1 SY0AAC19YG14RM1