Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3882
Length(NT) : 737
Best Gene Model Blast : Link to GSTUMT00007630001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein PGUG_01015
Accession: ref|XP_001487638.1| Score: 305 E_value: 3e-26
KEGG Definition: predicted protein
Accession: pic:PICST_31264 Score: 304 E_value: 2e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2425 Score: 386 E_value: 3e-38
PFAM Definition: Las1, Las1-like. Las1 is an essential nuclear protein involved in cell morphogenesis and cell surface growth..
Pfam Number: pfam04031 Score: 447 E_value: 3e-45
Swissprot: O42936|LAS1L_SCHPO
Gene Ontology:
GO:0005635 = Cellular component: nuclear envelope

Sequence:
>Contig3882
TTGGGCCACCCTTCGGATCTGCACGACCTAAAATCCTACTTCTACCCCAC
CTCCCCCTCCCCTTCCACGGCTCCAGATGCAGACCCTCGCCATCAGGCAA
TCCAAAAAGTCCGCGCCTGGAGCACGCGCACGCGTATCCCCCACTCAATC
GAGTCCACGGCATTCCTCGCACAGGCAGTCCTCACGGACACTCCGTCGGC
ATCACAGCTCTCGTCGCGGCTCTGCTATGCCAGCGCTCTCTGCCGCTTCG
TAAACGGCCTCCTGGACCCCGCCCAAACCTCCACGTTTGCACTGCCAATG
CACACACTGGCAAAAACGCTAGGCCTGCCAACCTCCTTTGTCGAGATCCG
GCATGCAGCAACACACGAGGCTCTCCCTAGCCTGCCATTGCTCCGCACTG
CGACGACTCGAGCGCTGGACTGGCTGTGGGAAAACTACTGGTGCAGCCTT
TCCGACTCTGACTCCGACCCGGAGCCGGCAGAGGAAGGGGGAATAAAAGC
CCGCGCCCTCCTAAAATCCTTCCGCACACTCCGGCGCGCAGAGCCCACCC
GTGCGCTTAGGTCTGGCGACGGGCGCGAGGAAACGAAACTCACCATGGGT
CTAATTAAAGAATGCATCTGCATTGCGGGTGACGGCTTGGTACAAGCACT
GCTAGAGGAAAAAGCACTGATCCCTGCCGGCAAGCACAAGTCCTCCTCAA
TGAAAGGCGCGATACTTCTCTGGACACCACTACTCGA

Sequences in the Contig:

SY0AAC19YF11FM1 SY0AAD40YO21FM1