Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3881
Length(NT) : 673
Best Gene Model Blast : Link to GSTUMT00000574001 E-value : 6e-99
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_03589
Accession: ref|XP_001244148.1| Score: 140 E_value: 3e-07
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02456 Score: 133 E_value: 1e-06
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG4364 Score: 229 E_value: 4e-20
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 247 E_value: 4e-22
Swissprot: Q09863|YAFA_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000939 = Cellular component: inner kinetochore of condensed chromosome
GO:0005634 = Cellular component: nucleus
GO:0007059 = Biological process: chromosome segregation

Sequence:
>Contig3881
TTGGCTCGAATGTTCGAACAACGGGTTCTTACGGCTTACCGGGAAAAGGT
TGCACGTGAGAGGCAAGACAAACTTTTGGAGGAACTTGACGAGGAGGCTC
AGCTTCGGATTCAACGTGAGGAAAAGAAGGCGAAGGAAAAGGAGCGGAAA
AAGGAGAAGAAACGTCTCCAAAAGCTGGCCAAGGAGGAGGAGCGGCTTAA
GAAGGAGGCGGAGAAGGCTGCGGAAGAAGCTAGACTCCGGGCAATTGAGG
AGAAGAAGGCGGAGGAAAATAGGAAACGAAAAGAAGAGCAAAGGTTGAAA
CGGGATGCTGAGAAGAAGGCGGCAGAGGAGGAACGTCGTAAAAAGGAGGA
GGAGAGGAGAAAGCGCCTCGAAGAGGAGCGGGAACGAGAGGCGGAGCGAG
AACGGAAGCGTAAGGAGCACCAAGAACGGGAGCGTAAGAAAAGGGAGGAA
GCCGCAAAAAAAGGCAAAAGAGGAAAAGGACGCTCGGGACAAGGAGGCCA
GGGAGAAGCGAGAGCGGGATGAACGAGAGAGGAAAGAGAGAGCAAGGAAG
AAAGAGGCAGCAGATCGTGAGAATGCAAGGAAGGAAGAGGAGGAAAGGTC
AAAAGCCGAGGCCCTTGCAGCTGCTACAGCTGCAGTCAAACGTCCACCCC
CTGTTTCGGTACCGGCATCTATA

Sequences in the Contig:

SY0AAC19YF08FM1 SY0AAC45YK15FM1