Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3880
Length(NT) : 768
Best Gene Model Blast : Link to GSTUMT00003399001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: uridine nucleosidase Urh1, putative
Accession: ref|XP_001265117.1| Score: 625 E_value: 3e-63
KEGG Definition: uridine nucleosidase Urh1, putative [EC:3.2.2.-]; K01249 DNA glycosylase
Accession: afm:AFUA_1G05530 Score: 624 E_value: 2e-63
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2938 Score: 382 E_value: 1e-37
PFAM Definition: IU_nuc_hydro, Inosine-uridine preferring nucleoside hydrolase..
Pfam Number: pfam01156 Score: 549 E_value: 5e-57
Swissprot: Q10314|YD62_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3880
TTGGCCAAGACCCGTATCTGGCTCGATTGCGACCCTGGTCACGATGTATG
TGACTGCACCTCTCACCCCACCACTTCTCAAAAGAAAAAGAAGAAAAAAA
CCCTCCTATTTTTTCTCTTTTTTTCTTTCAATGATCAATCTGCTGAAATT
GACACTTAGGATGCATTCGCCATGATTCTCGCAGCCGAACACCCCAATCT
CGAACTCGTTGGTATATCTACTGTCCATGGAAATTCCTCGATGGATAACG
TAACTTCCAATGCACTCTCGCTACTCACCGCAATCGGAAAGACAGATGTC
CCAGTGTACGCCGGATCCCGCAAACCTTTCATGCGCCCTGCCGTCCACGC
TCCCGATATCCATGGAGACTCTGGTATCGATGGTACCACCTTGCTGCCCG
AATCAAAGGTCGCTATGAAATCAGGAAATACCATTCTAGCCATATACGAG
GCTATCATGAAAACGCCGTTTCAGACTTGTGCGGTCGTAGCCACCGGAAC
TCTGACCAACGTTGCGCTATTGTTCGCCGCTTTTCCAGACGTAGTGGGAC
ATATCCGATGTGTTTCCATCATGGGAGGAGCTTTTGGTGGAAGAGAGGAC
GCGAGGGGAAACATTACCAAGTGGGCAGAATTCAATATCTATTGCGATCC
CGAGTCTGCCCGATCGATATTCTCCAACCCGGAGCTTTCCGGCCGGATAA
CACTAGTTCCTCTAGACTTGACACATACGGTCCTCGCGACCTCTGATGTC
CTAACCGCGCTTATGACG

Sequences in the Contig:

SY0AAA41YK21FM1 SY0AAA57YJ11FM1 SY0AAC19YE05FM1
SY0AAC25YL18FM1