Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig388
Length(NT) : 2160
Best Gene Model Blast : Link to GSTUMT00002229001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001216596.1| Score: 964 E_value: 1e-118
KEGG Definition: glucose-6-phosphate/phosphate and phosphoenolpyruvate/phosphate antiporter
Accession: aor:AO090102000644 Score: 964 E_value: 1e-117
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG1441 Score: 510 E_value: 5e-52
PFAM Definition: TPT, Triose-phosphate Transporter family. This family includes transporters with a specificity for triose phosphate..
Pfam Number: pfam03151 Score: 310 E_value: 8e-29
Swissprot: O94695|YG1B_SCHPO

Sequence:
>Contig388
TTGGAACACAAGTCTTCTCTTTCTCTAGCTTCTTCACTTCTGCACTTGTA
TATCTCTATCTCCACACTCTTTCCTTACTTCCATCCTCTTCATCCCTGGC
ACTGACTGTGTTTGTGTCCTCCGAATGATAGCTTTATCGCCGCCGACACT
CGTTTAACCTTGTTCCCAAGTTCCCGCGCAATCCCCCACGCCCGCTACCC
ACACGCAGAGGGAATAAAACCGTTGAGATACGGTATCAGCCATGCCTTCC
CGTTCCCCTCCTATCGCTGCCTTCGAGTTTCCCTCTGGCAACGGGAATAC
TGTTCTCCCAACGTCTTCGGCCGCGCGCGCTCCTTCCCCCCCCAAGCCGG
AGGAATACTGGCAACCTCGAGCTGCCCCTCATCACACTCATTCGCATACT
CGAACTGCATCACAGGTTTTGGGGAAGATGAGGTACGGCAGGGGTAGAAG
TGGAAGCGTAGCCCAGGCTGCGGGCGAGATAGCAGATTCCTTGAAGGCTC
CGCTCAGCCCAAAACTTATCGCACTATGCTTGATTTGGTATTTCCCGTCT
TGGGTCGTTACATTCCTTCAGCGCATCTATTTAATCCCCCAAACCGCAGG
TATCTGTCTTCTGCGCTATCAAACACCTCTTCGAAAACAATACTCAATTC
GTTCCCTCAGCCCGTAACCCTCACAGTCGTTCAATTCGCATTCGTCTCAT
CATGGTGCATCCTACTCTCAGTTTTCGCAAAATTCACTATGTTACGATCG
GCACCCGGTCTTGCTGGCGGACTGAGATTTCCTACAAGAGCTGTGATTGC
AACTACCGCACCGTTAGCCATATTTCAAGTAGGAGGACATGTTGCAAGTA
GCATTGCGACCCAAAAGATTCCAGTGAGCTTAGTACATACAATCAAGGGA
ATGTCACCTTTATTCACCGTGTTTGCCTACCGTCTTCTCTTCAAAATCAA
CTACTCGAGGGCGACCTACATATCCCTTCTCCCTCTCACCATTGGTGTCA
TGCTGGCCTGTTCTGTTGAGTTTCATGGTAATTTGTGGGGAATCACCTGT
GCGTTCATTGGGGCGATCATTTTCGTGTCGCAAAACATTTTTTCGAAAAA
ATTGTTTAACGAGTCGTCGTCAACTGGTGCGGATCCCTCAGTCCCACCTC
ATAAGAGGAAGTTAGACAAACTCAACTTGCTATGTTATTCATCCGGAATG
GCCTTTCTACTTACATTACCCCTCTGGTTTTATTCTGAGGGGTTTCAGCT
TCTTCAGATCTATACACGTGAGGGGAAAATCCCACTGTTGGATCGAATTG
GGAAACACGGAGAGGAACCACTGGCAGGACATGAACTTGTGATGCAGTTT
ATATTCAATGGGACAGTCCACTTTGGCCAGAACATAATTGCCTTTGTATT
GTTGAGTCTTGTCAGCCCAGTCACCTACAGCGTTGCAAGTTTGATCAAGC
GGATATTCGTGATTGTTATGGCAATTGTGTGGTTTGGTAACAAGACTACA
ACTGTACAGGCTGTTGGTATTTCATTGACGTAAGCAATCCGATTCTTTTG
ACAGGAGGCTGGAGGGTTAGCCTGGTCTGCTAATGAAATTGGCGCACAGG
TTCTTTGGCCTATATCTCTACGATAGAGCCGGAGACGTTGCGAGAGGTGA
GCGTAGGGTCCTTATGGAGCAAACAAAAGCCCTTGAGCCGCTTCTTCCCA
TCACCGCAAGGAGTGGAAAACAATCACCGCTACCTGGGAGATTTCTCCGC
CCAAATGGAGCGAACGGCTATGCAGTAGGCTTAGGAGAGAAGGCAGGGAA
TGGGCAAGTTGCCGGCAACTCTGCCTGGCTCGCTCCGGGAGCAAGACAAG
AAGATACATGGCGGCCAAGGGAAACGGCTGTCGGTGCATAGCTGTCTTCC
TCCCTTTCGTTCTTTTTCGCTTTCCCATGTCTTTGGTGGGAGTGGGGGGA
TATAACTATAATAGACTTCTATTTCTTGCTTGTCCCGCCTCCCTATGATT
TTTTGTTAAATTATCATTACGAGAACTGATTTGTTGGTTTCTTTTTGTTC
GATAGGGAAGGGAAGGGAGTTCATTGCTTTGTTGGTGTGATGTAGCTTCA
TTGGGGGTAAAAAGGAATGTTTGTATCATACGTGACTCAAAATCTAAAGC
CAGAAACTAG

Sequences in the Contig:

SY0AAA22YJ15FM1 SY0AAA26YE02FM1 SY0AAA26YE02RM1
SY0AAA34YG23FM1 SY0AAA39YP10FM1 SY0AAA57YK11FM1
SY0AAB8YL06FM1 SY0AAD9YE03FM1