Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3879
Length(NT) : 501
Best Gene Model Blast : Link to GSTUMT00006084001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein FG05224.1
Accession: ref|XP_385400.1| Score: 436 E_value: 7e-42
KEGG Definition: hypothetical protein
Accession: fgr:FG05224.1 Score: 436 E_value: 4e-42
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2489 Score: 409 E_value: 4e-41
PFAM Definition: CLPTM1, Cleft lip and palate transmembrane protein 1 (CLPTM1). This family consists of several eukaryotic cleft lip and palate transmembrane protein 1 sequences. Cleft lip with or without cleft palate is a common birth defect that is genetically complex. The nonsyndromic forms have been studied genetically using linkage and candidate-gene association studies with only partial success in defining the loci responsible for orofacial clefting. CLPTM1 encodes a transmembrane protein and has strong homology to two Caenorhabditis elegans genes, suggesting that CLPTM1 may belong to a new gene family. This family also contains the human cisplatin resistance related protein CRR9p which is associated with CDDP-induced apoptosis..
Pfam Number: pfam05602 Score: 407 E_value: 6e-41
Swissprot: Q6DEL2|CLPT1_DANRE

Sequence:
>Contig3879
ATCGAGTGATACGTCATGACAATTCATAAGTTACACCACCAATTAGTAAC
ACCACGCAACCCCACCCCCACCTCCGATTAAGCCAAGATACGTCTATAAC
AGCTATAATATTCCATCATCTATTTTCTCTTGGTGGCCTTCTTGCCTTTA
TCTGCTCCGTTCGTTTTCGCCCCCACTCCAACGGGGGTGGCGCCCTCAAA
TTCCTTCTTGGCTTCAATCTCCTTCCTATCATCCTCGCCGTCATCAGCTC
CTCCCTGTCCAAATTCGTTGACACGTCTATAATCCACTCGGTAGATCCAG
GCTTGGTATAGAGCAATGAAGTAGATGACGTCGTCTCGAAGTGTCGCGAG
TCTGTGGAGCGTGGGCATCTTAATTGTAAACGCGAAGAGGTCGTCGATAA
AAGTGTTAAGCAGCTTGTAAATCATGGTCTTACGAGGCATATGCGCGACA
GATTTAAGACGGTAGTTGATATACAAGCTCGGTACCATCATCAGGAACCC
A

Sequences in the Contig:

SY0AAA32YL03RM1 SY0AAB44YO17FM1 SY0AAC19YE01RM1