Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3878
Length(NT) : 459
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3878
ATATAGTATATTATTACTACTGATTATATTATTACCTGCTGGTTATAGGT
ATATTAAATGTTAAATTTAATTAAACTAGTAAAAAAAAAAGTTTAATAAT
TTACTATATCATTTTTTGTTATATCATATTTCCTATTTTATTTTCTAATC
GGATTTATGGATAAACAAAAATCGAGGAACTTTTTAATGTTTTAGTTTTT
CTTATTTTTAGCTGAAAGCTATTACATAAACTGTTATTGCTGTATAAAGT
ATATTAAGCTAATGCTCTTTTTTGTTTGTTATATATTACTTATAGTATTA
AAAATTGTAATAATTTTTAATTATATTTTTAATATTACTATAAACTTAAC
CTTAATATGTAGCTAAGGAGGAAAATACACACGATATGGTATTTATATAT
AAAATAAAATCGCTTACATCTACCTATAGATTAAAAATGTTATTATTAGA
AATAACTTG

Sequences in the Contig:

SY0AAA29YO16RM1 SY0AAC19YD21RM1 SY0AAC25YF04RM1