Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3875
Length(NT) : 1326
Best Gene Model Blast : Link to GSTUMT00011874001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_505765.1| Score: 243 E_value: 1e-18
KEGG Definition: hypothetical protein
Accession: yli:YALI0F22781g Score: 243 E_value: 6e-19
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2902 Score: 239 E_value: 8e-21
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 112 E_value: 4e-06
Swissprot: Q9UTI0|PYRC_SCHPO

Sequence:
>Contig3875
GGCCACGTCCGGGGATGCAAAGTTTTTTCTGGGAACGGACTCGGCGCCGC
ACCCGCGGGAAATGAAGATTGGGTCGAAGAACGGGAGGACTGCCGCTGGG
GTGTTTACGCAGCCGTACGCTGTGCAGTTTGTCGCTGAGGCATTCGATAA
GGTGGGGAAGTTAGATATGTTGAGGGGGTTCGTGTGCGACTTTGGGAGGA
GGTTTTATAAAGTGCGGGAGAAGGAGTTGGAGAGGGAGCTCGGTGCCGAG
GTGGGGATTCTACTGAGGAGGGATGGGGATGAGGTTGTTGTTGGTCAGAT
TGGAGAGAAGGATAAGATTGTTGTGCCGTTTAATGCTGGGAAGGGGGTGT
GGAGCTTAGCGTGGAAAGGGGAGTCTAGTGGGGATTATTAGATTTCTTTC
TACTAAGTATGATATCATAATAATAATATTATGAAGGTCATGGTATCATA
GCACCTTGAAACAATCCCCAAGTTTATCAAGTGTCACTCCTTCTTAATTC
CCAGCAAGCTACACCTGCCTTCCGAAAATCCTCAGACCTAGTCAATATGC
TCTCCAACAACACCTAAACTTAAACCACAAGGTTCAATCTAAAATTCTTG
GCAAAAACACACAACATGATCCATCTCATCCATCCGTCCGTGCGTGCAGA
ACCTCACGTTTATCCACGCCTCCTCCGCCTTCCTCCCAACAACTGTCGCA
ACAACAACCAAGAGCACAAAACGACCACCCCGACCAACGCCACACTTTCC
AGGCAGCAAGAAGCTCAGCTCGCGAAATAAACAAAATGTCCCTAAACCAC
ACACCCCCCGCGAAGCCCGCAACAAACATCTGGTCGGTAATGAACTACCA
AGTGCCTCGCGGCAAATGTGTCCACAAACTCGGTGTCCTAAGCACCTCCT
GTCCCTGCCTTCGCTTCATGCTAAACCCGCTACAAGCTGCGAGCAGCTTC
GCATGCGACGGCTGTGGTCACCACGCTTCGTTTCACAATCTGAGTAATCC
GGGCGAGGAGTACGAGGTTACATTGATCGCCGAGGGCGAGCGTGACGGGA
GGAAGATGGTGACGAATGGGAGTGGGAACGGGAGTGGGAGGAAGAGGAGT
TCGATGGTGGCGGGAAATGGGGTGCGGGGGCAGCTGAAGAATGGGAATGG
GAGGGAGAGGGGTGGGGATAAGGATAGGGGGGATGACAGGGAGGAGGGGG
AGGAGGGGGATTTGGAGTGCCAGGTTGTTAAGAGGGTTAGGAATTAGTTG
TGTGCTTGTAAGCTGTGGGGGAGGGGCCGTTGGGGGGTAATATGTCACGA
TACGGGTTCAAGTCTTTTCTTTTTTT

Sequences in the Contig:

SY0AAB44YD21FM1 SY0AAB45YJ04FM1 SY0AAC19YC19RM1
SY0AAC25YO09FM1