Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3874
Length(NT) : 2419
Best Gene Model Blast : Link to GSTUMT00010334001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001264060.1| Score: 996 E_value: 1e-105
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G16980 Score: 990 E_value: 1e-105
KOG Definition: No Hit Found
PFAM Definition: TT_ORF1, TT viral orf 1. TT virus (TTV), isolated initially from a Japanese patient with hepatitis of unknown aetiology, has since been found to infect both healthy and diseased individuals and numerous prevalence studies have raised questions about its role in unexplained hepatitis. ORF1 is a large 750 residue protein..
Pfam Number: pfam02956 Score: 115 E_value: 4e-06
Swissprot: Q9Y236|OSGI2_HUMAN
Gene Ontology:
GO:0007281 = Biological process: germ cell development
GO:0007126 = Biological process: meiosis

Sequence:
>Contig3874
GTCTCGATTCTTTCTTCCTAGTGCATTTTTTGATATAACCCGTTTTCCTT
ATCCCCTTTCCCATTTCCCCCCCCTCTAGGCCTGAGCCTAGACCAACACA
TCCCCCACCCGTTACGTTAGAATTTTCTCTCCCTATTACTATTCCATATT
ACAGGACCTTCTCATTTCTCTCTCACTCTCTCCTTGTCCTCCTTCTTCTC
CTCCTTCTTCTCCTCCATCTACTCCTCCATCTTCTCCTTCTCCTACAATC
CTGCATTCCTTTAACTTATCACTACTTCCCACCCGATCTGAGAAACCAGA
GTCTGTTCTGAAAGGTTGCAAGTGCACAATTGCTTGGTAATCCACGCCAA
AGCCCGAAACATGGCCTTAGGAAGACCTACGTCATCCAATCACATTCCAT
CCGAAGACGTCAAGTGCGTAGACACGGTAATAGTAGGAAACGGACCTTCG
GCTTTATTCTTGAGCTACCTACTTCATGGTAACATCCCTACTTACGATTC
CGCTACCCACGGACCGCACCCCGACCCGGTGCTCCACTCAAAGCTCTCGC
GATATGGGAACCGACCGCTCTTCGACGTAACCGAGTCCGCGAGGGCGTGC
GAGGCGCTAACGGAGCACTTCCATGCCGCCACCCACATGAGCTATTCGAA
TCAGGCTCTGCCGCTGAACGTTTTGCTGGACACGCTGGTGCAGCCGGGTG
CTGACACGGAGATCGGGGGGGCAAAGTCTCGGTTGAAGTGGAGTTTTGAC
GAACGGAGGAGAATCGGACATGTTGTTTTGGGCTCGGCAAAGGAGGCTGG
CGGACAGTGGGCCGAGGATCCAGTTAACACTTCCTGGGACATTGAGACTT
TGAGCTATTCGGAGATGTTGTCACTGCCAGGGTACTCCTTTCGGGAACAT
TATCGGAGGAGGCACGGGAAGGCTATGCCCCATCTTAATAGGCCCACGAG
GCGAGAGGTAGCAAATTACTACAGCTCGTACCCTCGCGCGGCGGGGATAT
CATCGGAGGTCTTCTCGTCGGTATATGCGCACCGGATAAACCGTACACAA
TTTGGTTTCTCGGTGAGGGTTTACAGGAAACCCACCTCGTCGAGACCGCA
ATGCGAGTACACAATCCACTGCAAGCATCTCGTCCTCGCAAACGGGATCT
TCACAAACGTCATACCGCCCCCACCCATCTTCCTACCATTGCTCAACCCG
GAGAACAACTCTCTCGGCCAACAGCAGCGCTTTAAGACCCTTCCACTACT
AGTCGTCGGCTCAGGCTTCACAGCAGCAGACGTAATCATCAGCGCGCAAC
CAAACCAGAAAATAATCCACATCTTCAAATGGAACACCACCCGCCCGTCG
CCGTTGAAGGGTTGCCATCCTCTGGCGTATCCGGAATACGCATCCATATA
CCGCCGAATGAAGCAGTCTGCCGCAGACAGTACCTCCCCAACGTCACCAA
CGACCCCATCAAACTACGAGGGTTTTCCGAACGCACAGGTCATAGCGGTA
TCCGGCGATGGGCGGGTCATCAAAATATTAACGGCAGACGGCGATGTCCT
GGAGCGCACCATCGGCACACTTAAGTACTGCGTCGGCCGGCGCGGAAGCC
TAGAGTACCTCTCCGCGGAGCTGCGGAAAGCCGTGGGCGTGCTAGATGCT
GCGTGGGTGTCCGCCGATACCTTGAGGAGACGGGTAGAAGCGGACCTGGA
AGTCACGAAAAACGTGTGGGTTGTCGGCAGCCTAACCGGTGATTCGCTGG
TTCGCTACGCGCTTGGAGGGTGTGTATACGCTGCTGGGAGGATAATGGCT
GATCGGGAGATTCCCGAAGATGAGCTGATTATTCAAGAGGCTGCCGCCGC
AGGCAGGCGGGGGTCTGGGTGTTTGGTTTCTTGATGGGCATGATGGCGAT
GATGTGGGATGGATGGGTTTTGTTGGGAGTTTTCGGAATAGAAATTCGTT
GGTGTCCTGGTAGATGATTGGTTGGGCTTTTTTTATCTTATTTGCTCCTC
CAGCGCCCTATGTGATACAGTACCGTACCCGAGTACACTGCGGTCACCAG
TACCATACGGTAGCTGGATGACTGGGAAAGATGCGGGGGTTGGGAATTGC
TGAGTAATTCTGGCGTGCTTGCTAGTTTGTCTTTTTTCAGATCATTGTTT
GGTGCGTTTGTTAGACTTTCCCTCCCTTTTTTGCGCTGTCTGGGCACGGG
CATAGGTGTATAATATAACTTTTTGCCTTTTTTTTTCACTCTTTTTTTAT
AAATTATTGTTTTTGCTCCTTGCCATTGGATTTTATGGGTGCTAGTGAAG
GTGGTACAGCCGTTGGAAACCGGAGTGGTATTTTTATGAGTGATGTTTTG
TGACCGCGAAAGTGGGCCAGGCAGGATGGAGTGCATTGGGGTCATGGTGT
TTGTTTGTCCTGGAGGGGG

Sequences in the Contig:

SY0AAA11YH02FM1 SY0AAA30YB09FM1 SY0AAA30YL17FM1
SY0AAA40YB24FM1 SY0AAA55YC13FM1 SY0AAA5YF03FM1
SY0AAA60YH13FM1 SY0AAB26YI19FM1 SY0AAB31YL03FM1
SY0AAB43YP16FM1 SY0AAB48YG20FM1 SY0AAB49YG10FM1
SY0AAB61YJ21FM1 SY0AAB7YJ04FM1 SY0AAC12YB17FM1
SY0AAC19YC18FM1 SY0AAC19YC18RM1