Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3873
Length(NT) : 875
Best Gene Model Blast : Link to GSTUMT00010782001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: manganese superoxide dismutase
Accession: emb|CAC83814.1| Score: 351 E_value: 1e-53
KEGG Definition: hypothetical protein
Accession: fgr:FG02051.1 Score: 331 E_value: 6e-52
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0876 Score: 268 E_value: 2e-24
PFAM Definition: Sod_Fe_N, Iron/manganese superoxide dismutases, alpha-hairpin domain. superoxide dismutases (SODs) catalyse the conversion of superoxide radicals to hydrogen peroxide and molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the Mn/Fe-binding family is one. In humans, there is a cytoplasmic Cu/Zn SOD, and a mitochondrial Mn/Fe SOD. N-terminal domain is a long alpha antiparallel hairpin. A small fragment of YTRE_LEPBI matches well - sequencing error?.
Pfam Number: pfam00081 Score: 220 E_value: 8e-19
Swissprot: Q92450|SODM_ASPFU
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>Contig3873
CCGGCCAAATTATGCAAATCCATCATTCCAAGCATCACCAAACCTATGTC
AACAACCTCAACGCTGCCACTGCAAACCACGTCAAGGCGCTCCAGGGAAA
TGACGTTCGTGCCCAAATTAATCTCCAGCAGGCTATTAAGTTTAATGGAG
GCGGACATATCAACCATTCTCTATTCTGGGCCAATCTCGCACCGGCAAAT
ACCTCTCAGGCCAAACCAGAGTCGGCAGAAAAGCTTACAGAAGCGATTTC
GGCCAAGTATGGAAGCTATGATGGGTTTAAAGATGAGTTCATGGGTGTGC
TACTAGGGCTGCAAGGTAGCGGGTTCGTACGCAAAAACTCACATTTAGTA
CTGAAAACGGCTGTTGGATCGGATCTCTGATCTTGTAATGAGATAGATGG
GGTTGGCTCGTGAAAGACAAGAAGACCGAGCAGCTTGACATAGTCACCAC
TAAGATCCTGTTGTTGGCGATCTCGCACCCATCTTGGGTATTGATATGTG
GGAGCATGCGTACTATCTCCAGTACTTCAATGACAAAGCTTCTTATGTCA
ATGGAATCTGGAATATCATTAATTGGGAAACCGCCGAAGGGAGATTCTTG
GGCCGAAGCGGAACATTGGAATTGTAGGCGATAGCATATTTTTCTTGAGG
ACTGTGGAAATTTTTATCTCGCACTTTTCAATAGGGCACCCTCAATTATG
GCTTAAGGTGTAGTAGGGACAATACGGCAATTATAATACCAAGCCTGTCG
AGTGATTACTTGTGAATATCGTGAGGACCGAGCAGTCTTAGCACGAATAC
CCGTATGCCACCATGGTTGGGGGGCACGTACCCCATCTGGCGTCGTCGTA
CGCGGCCTCTCTGGCGCGTACCTTG

Sequences in the Contig:

SY0AAC19YC08FM1 SY0AAC19YC08RM1 SY0AAC21YP09FM1