Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3872
Length(NT) : 2542
Best Gene Model Blast : Link to GSTUMT00008091001 E-value : 0.0
Numbers of ESTs : 26

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR00673.1| Score: 214 E_value: 6e-15
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3872
TTGGCCTCGACCCCCTCCCTCATTCTTCCTCTTCTCTCTATCCTTCTCTT
CTCTGTTCAGTGCACGGTGTTGAACTGCGTCTTTATCCATCTACAGCCTC
ATCTCTCCTCCCCACCCCTACAACGCCCCTATCCATCGTCATCACTGTGT
TTGCCAGCCTTTTCCCCTTGTCTTTTCCCTCTCGTTAATATTTTCACTCC
TGCCACGGTGGAAAAATTCTTGAAATCTGCTTTCGGATTATCAGCGGAAA
TCAGCTGGTTTGCTCACGATAAGGTCTCGTTCGACAGTCAACAGAACTGA
AAACACCAGCCAACGAGACTCAACCTAGTTGGCCTGCCCTATACCGCGTC
GTGAAAACGGCAATTCTTCTCAGGAGCGCTACAGGGGTGCCGGATATAGT
GGATCTCAAGGGCTCTTATAGTGCGCTAGATTACCATTATTGACGTCCGA
GTAATCACCCGCCACATCCTGTTCGCCCCTTGGCTGGTAGATTCGGAGCC
ATGGCCAACCAACTCGACCCGCACCACCTGGTGGCTCTGATGTGCTACGA
ATTCAGGAGTGGGCAAGATGGTTCCACTCGCCGCTTGGACCCTCCCTCTG
ACCTCACATCCGGTATCGTCGACCACCATAAAACAAACGTTCGCACCCGC
CCTGTCATGGATGCCCTTGCCCACATATCTGTTTCTCAGCCAAATTCTCA
TGTCGTTGCAATAGCTCTGCAGTTGAAACACGGTACCAAAGAAATTCGCT
TAACGATCGCTGAGAACGAAGACGTTGGCGATAGCCTTGTTAACCATCTC
TACAATATATGGGGAAAGTTGCAGGCTTTATCAGACGAGTACGCGAGGCA
GAGAGCTGAGGCGCGGCATGGGAACCAGGGGACCGAGGAATTGGATGGGG
ACCCGATCCCGTCGCCACCCATGCCCCCGGAGGTAGGACAGCCTTTGAGG
ATAGAGGTATTTCGCGAGGTATACCAGTACTGCCTGGAAAAGCACATGAA
GCGGGTGAAGAAGTGGTTGGGACGTCTTTCTAATTTCATGGAGGAGTTGT
ACGAACGCCGTAAGGGCGTCGGTCTAGGAAGGTTTGAGCAGGACCTGACC
AAAGCTGCGATTACGTTGGCGTCGGCACTAAAGCTAGTTCGCAAGCACTC
TAAAAGGGAACTCACAAATGATGAATGGGAAAAAGTATATTGGCTAAGCA
TGAATTCTAATTACAAGGCAAAACTTCTGCTTGCAGATAGCCACGGGCTC
GGCTGCGAGAGGTTGGCCCGGGAGTTAAAAGGCGACCATTCCGGAGACCC
CTTCCCGCTTCAACGCGCTCTTGAGAAACTGATTTCGTTACCCCGCCACA
TTCAATCTCTCTTTGGGTTTGCCCATTCTCCCCGCCTCCGGCCCGCCTTG
CAATACCGCATGACGATTTGTGCTGTCCTGGGCCGGGCTCAAAAGGTAAA
ATTACCTGCATCGGAGGATGAGTGGAAGTCCTTTTTGAAGGTTGCAAGTG
GTGAGGAAGGCGCGTGGCAGGAGGATGATGCAAGGAAGCTATTTAAAAAG
TTTGGGCCGCTAGAACGGGAGTGCCCAGTCCACTGCGAATGTGGGCTTAT
TCAGTACCTCCAAACTAAACATGGTGATTCATGGGACAATGTCCCTGCGT
TTAGCTACATTGGAGTCTCCAAGCTAAGCTGCAGTGCCTGCCGCGTCTGG
ATAGAAGCCTTCAACGAGCTGCGGGGACCAAAGTTTTATACCCGAGGCTC
GCATGGAAAATGGTATTTTCCTTGGGGGATGCCCATGGCGGAGGGGCCCT
TGAAGGAGAAGATGAGAGAAAAGGTTTTGAATGAATACATCACGCAGCTA
GAGGATGAGGGGAAGATTAAGAAGAGAGCAGGCTCGGATAGCAGTGGCGC
GATCTCATCTGGGGCAGAGGACAATATAGGTAGTGATCGCAGACAAAGCG
CTGATGCTTGGGCTGACGCGGAAGTGCAAGAGTCCGGGGGAGACCCGGTG
GGGTTTCTTAAGGCCGCTGCCCAAGAGTAGAGACCGGCGACATGAGCCAG
GGCTGGGTGATATTTGGGAAATGCTGGGATAAATAGATAGCATAGGAGGG
GAGGTTTGATTTTGTTAGGTCGGTTCGCTGTACTCCCCCGCTCATTGACT
CCCCTCCTGTATTTTAGTGGTTTGGAGACAAGCTGACCCTTTTTTTTTTT
TTTCACTCTCCCTTGGTTTTGTGGGTGGAATTTGAAAACATCTAGAAACT
GGCTACCGTATGCACTTGTCTGCGCATTCTATTGCCTGCTTTATTACCTT
GTGGTCTAGTAGTCGGTTTGAGCTGGCATTCCTTGGTAGTTCTTGGCGTC
TATTGTGCTCCATTACTTGATTTGCCAATCTGGGCAATTTCTTGGCTGTA
TACCCTTTTTTCCTCTTAATATGAAAGCTTGACTATTTTCCATCTGTGGT
TAGTGTTATCCTTGAGCTTGATAAAATTATGTTTACAGTTTTTTGCTTCC
TTTTCTATACTCTGGTTTTCCTTGCTACCCCAACATCTGTAT

Sequences in the Contig:

SY0AAA18YH22FM1 SY0AAA37YE21FM1 SY0AAB1YI11FM1
SY0AAB51YP09FM1 SY0AAB51YP20FM1 SY0AAB52YD19FM1
SY0AAB54YA13FM1 SY0AAC10YJ11FM1 SY0AAC15YO07FM1
SY0AAC19YB20FM1 SY0AAC32YJ17RM1 SY0AAC39YC07FM1
SY0AAC3YC05FM1 SY0AAC40YL22FM1 SY0AAC50YC21FM1
SY0AAC57YK19FM1 SY0AAC58YC14FM1 SY0AAC59YE07FM1
SY0AAC5YO17FM1 SY0AAC60YA14FM1 SY0AAD14YM01FM1
SY0AAD16YC05FM1 SY0AAD40YG07FM1 SY0AAD41YH12FM1
SY0AAD42YG22FM1 SY0AAD58YP03FM1