Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3869
Length(NT) : 909
Best Gene Model Blast : Link to GSTUMT00007890001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein MGG_06334
Accession: ref|XP_369819.1| Score: 455 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06334 Score: 455 E_value: 9e-44
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis, Signal transduction mechanisms].
Kog Number: KOG3791 Score: 159 E_value: 9e-12
PFAM Definition: No Hit Found
Swissprot: Q7RZQ3|VTS1_NEUCR

Sequence:
>Contig3869
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGAGGAATCCTCCTCCTCAA
ATTACTGGAAACACGAACCTTCAGACCACCACCTTGAACGCGCCCACAGC
TACCGGTATTGAGATGCCCCAACTTTCTCCCTATGGTGATACATCATCCG
GCAATTGGGCATCAATGGTCAACACACCTGTTGCGCCAATATTTTCGCAA
TCGCCGGGAGCAGATATGGTTGCCAACGCTGCTGCCATGAAATTAGCTGC
ATTGTCTACTGTTAATAACCGGATTATCCTTGATAACGATCCTAAAGGAT
GGGGAAAGCGCAGAACCGGAAAGGATCCTAATGGAAGCAACGGGCATGGC
AATGCCGGGCTCAATTCTCCTCGGAATAACGGAAATATGGCCACCTTGCC
CCAGGGCGCTATCGCTATGTACAACGAGCATGGCCAATTGGTTCCGATTC
CGACGGCTGCGGCTGCTGCAGCCATGGCACAACAGCAGAACAATGGCTCG
CCGCTTCTTGGAGGCCGCTCCCGCCCGAACTCGCCCGGCGTGTTCAACTC
ACCCGCCGCCCAGTGGGGCGGTCTAGGATTTGCCTCTCCTCAAGCTGGTG
GCTTTCTTGCTGCTCAATCACCCCTCCTCGGGAATAATCTTCTACCCACA
TTCGGTGGTCTCGCTGGGTCGGCTGAAGGTTATAATTCTGATGATGTCAG
TGGACGCGGGAGGAGCCCGAGAGGCAGACGGGGAAGCTCTAAGCCTCCAG
AGGATCCGACCGACCCTAACCTTCTGAACGACATTCCTGCCTGGTTGCGT
AGTCTCCGTCTCCACAAATATACCGATAATTTGAAGGATCTCAATTGGAA
AGATTTGGTCGAGTTGGATGACGAGGCACTTGAGAAGCGAGGAGTGAATG
CTCTCGGAG

Sequences in the Contig:

SY0AAA47YD15FM1 SY0AAC19YA07FM1 SY0AAC30YN13FM1
SY0AAC44YH10FM1 SY0AAC57YM04FM1 SY0AAD63YI05FM1