Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3867
Length(NT) : 789
Best Gene Model Blast : Link to GSTUMT00011635001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein AN3632.2
Accession: ref|XP_661236.1| Score: 570 E_value: 6e-57
KEGG Definition: hypothetical protein
Accession: ani:AN3632.2 Score: 570 E_value: 3e-57
KOG Definition:
Classification: [Nuclear structure].
Kog Number: KOG2439 Score: 446 E_value: 4e-45
PFAM Definition: Fe_hyd_lg_C, Iron only hydrogenase large subunit, C-terminal domain..
Pfam Number: pfam02906 Score: 216 E_value: 2e-18
Swissprot: Q9Y7N7|NAR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3867
TTGGCAACCACACCACAACATAATAATCGAATACATCACAGCATAACACA
CAACTAACCACGACACAAATCCAAACCATGAGCGCGATCCTCAGCGCTGA
CGACCTAAATGACTTCATATCCCCAGGCGTTGCCTGCATAAAACCGATTG
AAACACTTCCCGCCGCTCCCAATCCGCCGCCGGCCAACTCCTACGAAGTT
ATCCTAGAAGACAAAGCGCCCCCAACAGATCTCCCACCCGCACAAATTTC
ACTAACAGACTGCCTCGCCTGCTCTGGCTGCGTCACGTCTGCCGAAGCGG
TCCTCGTCTCCCTCCAATCCCACAACGAAGTCCTAGCGAATCTAAACGCT
CACCCGAAGAAGTTATTCGTAGCGCTGATATCCCCGCAGTCGAAGGCGAG
CCTTGCTACAGCTTATGGTGTCAGCGCCGATGTTGCTGGACACATGATTG
AACGATTGCTATGTTCTCCAGAGGGGATTTGCCGAGAGGGCAGGGGGTTC
GATCTTGTCCTAGATACAAATGCTACTAGGGAGGTTGCGGTGAGATGTGC
TGCTGAAGAGGTTGTTATGGCTATGCAGGGGGGTAAAGATGGAGTTAATG
GGAGGAAAATGCCGATATTGACGAGCGCGTGTCCAGGTTTTGTGTGCTAT
CTGGAGTCTACCCAGCCGGCGTTGATCCCACACTTGTCGAGACTGAAGAG
CCCGCAGGCGATTTTGGGGACAGCAGTGAAGTCACTATTGCACAAGGATG
TGGAGGACGGAGTGAAGGGGATTTATGTGGTTGGTGTGA

Sequences in the Contig:

SY0AAA50YE22FM1 SY0AAB2YD22FM1 SY0AAB52YI18FM1
SY0AAC19YA02FM1 SY0AAC52YD24FM1 SY0AAC55YD17FM2
SY0AAD21YE12FM1 SY0AAD33YP08FM1