Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3865
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00003851001 E-value : 1e-112
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3865
TTGGCAACCTACCGGTAGTACAACAAGCCCTATTCCACTATAAGTGAGTC
CAAACAGCTTCTGTGTTTTTATTCGCCAACATGTCGGAAGATTGGGCCAA
GACGACCACGGAGGAGCTTAAGAGCCAATGCGATGCGAGAGATATTGAAA
ATCATGGAACTGAAAAAGAGTTGGTCAAACGTCGAGAAAACTATGAAAAA
GGCGAAGAGAGGGAAAAAATGAAAATGCCTTCCATACTCTTGAGTATGAT
GGAAGAGCAGTGTGATGCAGTTTTGGTCACTAAGGCAGATACCGGTATCA
GGGATGATGACGTGATGATTGACGATGGGAAAAGGCCTTCCGAGATATCC
TTGAGAAGGGCCAACTTGAGATGGGTTATGATATGGTGCCACTTACCATT
CGGAACCCGGCTGGACTTAGCCTTGCAAGTTTGTCCAGAAAAATAAAAGT
TCTCCAGTCCAAGATTGCGACACTGGAGGCAAAAAATATGTCACTTACAA
GCGATCTCGCTTCCCACACAATCCAGATCAACTCCTTACAAAGCCAGGTA
GGAGATCTGACACTGTCTCTAGAGGCGCACACACTTGCCCGGCACCAATT
CATTTCTACTTTCAAACGGGACAAGTTTGGTG

Sequences in the Contig:

SY0AAC18YP15FM1 SY0AAC59YA15FM1 SY0AAD43YK18FM1