Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3863
Length(NT) : 1011
Best Gene Model Blast : Link to GSTUMT00011376001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CC1G_04235
Accession: gb|EAU88529.1| Score: 959 E_value: 1e-102
KEGG Definition: KTR1; Alpha-1,2-mannosyltransferase involved in O- and N-linked protein glycosylation; type II membrane protein; member of the KRE2/MNT1 mannosyltransferase family [EC:2.4.1.-]; K03854 mannosyltransferase
Accession: sce:YOR099W Score: 946 E_value: 1e-100
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4472 Score: 1206 E_value: 1e-133
PFAM Definition: Glyco_transf_15, Glycolipid 2-alpha-mannosyltransferase. This is a family of alpha-1,2 mannosyl-transferases involved in N-linked and O-linked glycosylation of proteins. Some of the enzymes in this family have been shown to be involved in O- and N-linked glycan modifications in the Golgi..
Pfam Number: pfam01793 Score: 1176 E_value: 1e-129
Swissprot: P27810|KTR1_YEAST
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0000026 = Molecular function: alpha-1,2-mannosyltransferase activity
GO:0000032 = Biological process: cell wall mannoprotein biosynthetic process
GO:0006491 = Biological process: N-glycan processing
GO:0006493 = Biological process: protein amino acid O-linked glycosylation

Sequence:
>Contig3863
TTGGCTCAAAGATGCCCTTGGCTCTATGAAACAGATCGAGGATCGATTTA
ACCGTCATTACCAGTACCCTTGGACCTTCCTTAACGACGAGCCCTTTACC
GAAGGGTTTAAAAATCATACCACTCGGATGGCGTCAGGAACGACAGAGTA
TGGGTTGATTCCCAAAGAGCAGTGGAGCATGCCGGATTGGATCTCTGAAG
ATAAGTTCCAGAAAGTCATTTCAAAAATGTCGAAGGAGAATGTGATATAT
GGCGATTCTCGGACTTATCGACATATGTGTCGCTACAACTCTGGCTTTTT
CTTCAGAGACAAGCTTCTAGCCAAGTACGACTGGTATTGGCGTGTGGAAC
CAAGCATCGGGTTCTACTGCGATATGACCTATGATCCGTTCACATTCATG
CGCGAAAATAAGAAGAGATATTCATTTGTGATTTCGTTACCGGAATATCT
CCCGACAATTGAGACACTGTGGAAGACAACTCAGGAATTCGCCAAGCTGC
ATCCGGAGCATATCGCAAGAAACAATTCATTGGGCTTCATAGCAACTGAC
CCCGATAAAGGAATTCAAGAAACCGACTACAATCTTTGCCATTTCTGGTC
CAATTTCGAGATTGCAGACCTCAATTTCTGGCGAGGAGAAGCATACCAGA
AGTACTTTGAATTCCTTGACAAAAAAGGGGGGTTCTACTACGAAAGATGG
GGCGATGCACCTGTTCACTCTATAGCGGCTGCTCTGTTCCTCCCCAGGGA
TCAGATCCACTTTTTCGGAGACGTTGGCTACAAACACGTTCCATGGGGTC
GATGCCCGCTGGATGATGAAAGCCATGATACTGCAAGGTGCATGTGCCCT
TTTGACCGCAAGGAGAGCTTTGACTACAATCAATGGAGTTGCCAGAACAA
GTGGAACAAATTCTGCGGATTTCCTGAAAACCCTATATATGAATGAGCAA
CCCATTATCGTACTATTTCATGACCGTTTTTATTCTTGCCCTGATAAAGT
TATTCTTTTAC

Sequences in the Contig:

SY0AAA57YM05FM1 SY0AAA62YH06FM1 SY0AAC18YP05FM1
SY0AAD56YH14FM1