Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3862
Length(NT) : 2128
Best Gene Model Blast : Link to GSTUMT00009863001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: C2H2 type zinc finger domain protein
Accession: ref|XP_001269828.1| Score: 215 E_value: 4e-15
KEGG Definition: predicted protein
Accession: aor:AO090005000778 Score: 196 E_value: 3e-13
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 175 E_value: 4e-13
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 184 E_value: 3e-14
Swissprot: Q09838|PRZ1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0003700 = Molecular function: transcription factor activity
GO:0019722 = Biological process: calcium-mediated signaling
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>Contig3862
TTGGGGAAAGTGCAGCAGATAAACGAAACATCTCTAGAATTGCCAAGAGA
GCCATCAACTTCTGCCTCGTTTTTCACTGCCTCGTCAACCTCATCAGACC
GGCTAGGTTATAAGCCAGCCAAACAAACCCGTAAACCATCACCACGATAC
ACCGAGGGCTCGCGACAAGCGTTCCCTCAAAAAAACACTTCAACGGACCC
CACTAGCAAAATTACGCTGAATTCCTATCTCTACTCTGGGTCATTGGACT
CAACCCACTCCCTGCCGGACGAGTCCTGGTCTCGTGGTTCATCCCCGAGA
CTAGAACAAGCTCATCCTCTTATATATCCTGACGAGCGGCGTAGCTCAGT
GGTATCTTTCGATTCGACAGTGGCTCCATCAAGTCCCCAGCCGGCCAGTC
CGAAATCGAAGAAAAGAGAGCGGCGGCCGCGAGCAACTCAGGCAGACACT
GTTCTCCTCAAGTTTCTTGCTCCTGATCAACCACAAGTCGCAATCAGGGC
TGGCGAAAGCCCGCTTTCTTGGTCAACTGGGAGTGAAGGTAACAACGAGA
TTGATATGGAAGGAGGTGCACAAGATGGAGATGGTGGAGGAGGCAGTAGC
AGTGGCGGTAAGGAAAATAGTCGGAATGAGAGCAGGGAACAATCCACCGA
TCAGCCGAATGGAGGTACAGGCGAGGAAAGTGGTGAAGGAAGTACGAACA
GCGGGGAATCTGGAGCCTATGGAAATGGAGGTGATGATGAGCGGGAGGGG
AATTCGGGGGGTGGAACGGGAGGAAAGGGAGGCCGTGATAACGACAAATG
CGATGATGAGGGTGTCAAAGGCAAGGATAACGAGAAGAAAAAGAAGGAAA
AAGACAAGGACAAAGATGAGGATAAGGAAAAGACCCAGTCCACAGGAACC
GACAATATGGACATTGACACCACCACGGCGGATGCGCCCAAGGGCCACGA
TGTTCCAGAGCCCGAAAAAATTGCTTCCCCACCTGAGTGTGAGGGTGGCC
CTGTGGAGATTGAGCTCTCCTCGTCCGAAACGGCGGTTAGTTTGATGGCC
TTGGCGGCTGGCGACGATCGCCAGCCCTTTACCTCTGCACCATCGTTACC
CGGCGTTCCTTCGAAAGCCGGTGGAACAGCTTGGGCTCCAAATGCAAGGG
CAAAATCGCCCAACCCCAGTCAGAGCCGTGGACCGCCCCCGTCCCCTAGC
CCTTCAACGCAGTTGTTTCAGGATAACAAGCTTCCACCGCCAAACTCGCC
AACTCAACTCCCCTCGATGATATCAACCATGAACTCCCAACCAGCAAGTC
CGCCGAACAGTCTACCACCTGGAAACGATGGGCGGCACACCACCCTACCA
CCGGTTTCATCGATCCAGGTTCTAGCAGAAATGGCCGAAAAGGCTATGCC
CACCCAAAACTCAAACCTTTGGACCAACAATCGCATGCCTTCAACCCCGC
GGACTGTCTATCCAACCGTTTCCTCCCATGTGAATGTTGCTCCTTCCAAC
AGACCCACCCAAGCCCCACAATCGCCTGGTCTTCCTGCCCCTCCTGGGCA
GTCCCAGCACGGTGGGTTCAGTTCGGACGCGAACCCCCGACCTCCGGTGC
ACCATTTAACACTACAGCAAAGGCAGTTCTATTTGAACCAGGATCCGCCA
TTGTCACCCTATTACACCAATTCGCACCAGCACTACCAGTCTCCCTACCC
CCCGATGAAGGAAGGTGCTTCGCCAAATACCAATGGGTCTACTGTTCCGT
ATCAGTCTAGCATTACTCATCCTCGCGAATTACCAGGAATTTTGCAAAAC
CATTCCTCACCTTCAAGCGCACCTGCATTCTTTACTCCTCCGGCTCTTCC
CGGGCGTAAGGATTCTACTACCATGGAATACTACTCTGCAGATAATACGC
CACCTTCTGGGCCCAGCACAGGGGACACAATGCCTAGCTCTGGTACTGAT
GATACAATAACGAGCCCGAGAAGTCGCTCAACTGTGGCCCCTAGTGCTCA
AGGGCCGTTGGCTAGCGGTGGATTCAAATGTGAATTTGCTGGTTGCAAGG
CTTCTCCTTTTCAGACGCAATATTTGCTTAATTCTCATGCCAACGTCCAT
TCATCCGCCCGCCCACATTACTGTCCAG

Sequences in the Contig:

SY0AAA22YP10FM1 SY0AAA42YO19FM1 SY0AAB40YO21FM1
SY0AAC18YP04FM1 SY0AAC40YM04FM1 SY0AAD6YJ02FM1