Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3861
Length(NT) : 799
Best Gene Model Blast : Link to GSTUMT00004098001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_04075
Accession: ref|XP_001594268.1| Score: 892 E_value: 3e-94
KEGG Definition: hypothetical protein
Accession: ang:An13g00210 Score: 870 E_value: 5e-92
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0521 Score: 186 E_value: 6e-15
PFAM Definition: No Hit Found
Swissprot: Q9UUE2|CSX2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0007264 = Biological process: small GTPase mediated signal transduction

Sequence:
>Contig3861
CTGCCCACGACCGGTGGATAGTACCATGGCGGAGGATGGCCCATTGTTTC
GAGCGACCATCAAGAGTTTGGAACAAAAGACTGGTACCCTGCGTACCAAA
ATGAAGAAAGTACTCAAAAGGGCTGAACAGGCACGGCAAGCACAGATTGT
ATGCAATGATGCCGTTAACGCGTTCATGGAATCTCTACGCGATGTTGCGA
GTACCGGAAATGCCTCTGGGATCCAACCGGCCCTGGATCACTACTTCGAG
AGCACCTACCGCGAGATTCTTTTTTTCGAGAGGCAGAACGAAATTAGCCT
TCAGAAATTAATCATTGACCCGCTCACGAAGCTCTATAACCTGGACATTA
AGCAGGCGGAGGTCAAAAAGAAGGATTTTGAGGAAGAAAGTCGAGATTAT
TACAACTATGTAAGCCGTTACTTAGGAATTAGGAACGATTCTGCGAAGGA
GAAGAAGAAGATCGAGAGCGAGACCAAATACCAAACAAAGCGGAGAGGTT
TTGAGCTGAAGCGATTTGACTATTGCACCTTCATGCAAGATTTGCATGGT
GGACGGAAAGAGCAGGAGGTTCTTTCTCAGCTCACTAAATTTGCAGACGC
ACAAGCCCGGAGTTACTTGACGACAGCGAAGAAGGTGCAAGAATTGATGC
CTCAACTGGAGGCGCTGAGCTATGAGGTGAAGGAGTCGGATAAGGAGTTT
CAACTGCAAAGGACTGAACGGGAGGAAAGGAGGCGTGTTTTGGAGAAGAG
CAATAAGACGTATGTTGAACCAGATAATCTTGCTTCCTTCATGCCACCT

Sequences in the Contig:

SY0AAC18YO20FM1 SY0AAC28YD05FM1