Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3860
Length(NT) : 1231
Best Gene Model Blast : Link to GSTUMT00004523001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An02g08830
Accession: ref|XP_001400017.1| Score: 429 E_value: 3e-40
KEGG Definition: hypothetical protein
Accession: ang:An02g08830 Score: 429 E_value: 1e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q4WYF1|HIR3_ASPFU

Sequence:
>Contig3860
TTGGGGAGATCAGAAGGGAGAAGGCAAAGAGATGGAGTTTCCTAGTCAGA
GATCTGATGTATTGTCGTCCAAAAGGTAGCGATGGCATTCTGGAGGATCA
ATTGACCATGAGATGTCTTTGGGCTATTGCAGTTTTCACGGCATTTACCG
GTGTTTCTAGAGAGTTCAGGTTGGAATGCTTTGGCGATTTGAAGGGTGTT
ATGTCCAACAATAAGCTCCACTCAATTGAGCTTCCCAACAGCTCCATCAT
GCCAGAAATCTCTGCCCTGAGGGCCGAGCGGGAAATCAGTAAGCTTAAGA
CTGTTGATTTCTTTACATCTATATTTCAAGTCACGGCCGATATAGGGGGT
GCAGCAAATGACCCCTATGAGGTTATCGAAATTCTTGAAGCCGTATTGGA
ACCCGGTGTTGGTAGCCCGTACGACGAGCAAGAACGCAGGATACTCGATG
AAATAACCAGATTTCTCGAAGGATCCAGTGCAATGTTTAGGTTGCACCTC
TGGGAGAAGCTCAAAGTAGCTCACGAAAAAGCAGGTCATCGCCAAAAAGT
CCTTTCTTGTGTATTGAGATCGTTAGAGGTTGTGGTTGGCGATTTGAAAA
GTAGGAGTTACCTCGAATCTTCGGAGGACCATCGCCACTTTGTTCTACTG
CGGTCATTACGTCTCGTGGAAGAGATGTTGCCCGTAATTTTGGGACTCGT
CTCTGGGGGTGAAGGATTGGTGAATCTGTCTGGAATTGATCGAGATGGGC
TGGTGGACTCGATGAAGTCAATGGCTATCTTGCTGAGACTTTTACATTGC
TACGCTTTTTGGGAGAGTGCTGTTCTCAACCATGAGATCTCGGCTAGCAA
CCTACATTCTTACCGCCTGGTCGTAGTAAAATTTAGGGAAATGATCGTAC
GAGCTTGGGTAGTGATGTACTCAATTTATAAAGAAACAGCGGACAGAGGG
ATGGGTAACGACAACCTCGATTTAGAGGAAGGTGAAAAGGAGGAACGATT
GGCAACCCTCCTAAGGGACATGCATCAAGAGCTTGGAGGCAGAAATTACT
GCCGGCTGTCAGATCATGCGTTACTGAGACTAACCCATGATGAACTTCTG
AGACTCGATCTTCGAGATTTTGATCACGATCTGTTGCAGTGCATTTTCTG
TCGATTTCATCTTGCTATATACTCTGATCAGGTTGTTTTCAACGACCACA
AGACAGATCCAGAGCCCTTCGACAAAGCGAC

Sequences in the Contig:

SY0AAA63YH07FM1 SY0AAC18YO08FM1 SY0AAC53YF09FM1