Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3858
Length(NT) : 952
Best Gene Model Blast : Link to GSTUMT00006395001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215515.1| Score: 898 E_value: 8e-95
KEGG Definition: mRNA transport regulator (Mtr10), putative
Accession: afm:AFUA_7G05970 Score: 863 E_value: 5e-91
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2081 Score: 434 E_value: 1e-43
PFAM Definition: Xpo1, Exportin 1-like protein. The sequences featured in this family are similar to a region close to the N-terminus of yeast exportin 1 (Xpo1, Crm1). This region is found just C-terminal to an importin-beta N-terminal domain (pfam03810) in many members of this family. Exportin 1 is a nuclear export receptor that interacts with leucine-rich nuclear export signal (NES) sequences, and Ran-GTP, and is involved in translocation of proteins out of the nucleus..
Pfam Number: pfam08389 Score: 136 E_value: 5e-09
Swissprot: Q9USZ2|YNR7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005635 = Cellular component: nuclear envelope
GO:0005525 = Molecular function: GTP binding
GO:0008565 = Molecular function: protein transporter activity

Sequence:
>Contig3858
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCAGCTGAGGCGGAAGATT
AGCTTGACGGAGGAGGAGCTTGAGACAAGATCTCGAGAACTACTCACGGA
TAACGCTACAGAAGTACTCAGGCTCCTTGTCCAATATGCGCAATCCACAG
CTGGATCTCCACCCAATCCTGCCCTAATATCGTGCGTAAACTCCTGGCTT
CGTGAGATCCCGGTTCTTGATGTCATCGGAACCCAGCTCATTGATGTTAT
CATCTCTGCACTCTCCTCAAATGCAGCTCTCGACCCTGCTGTTGAGTGTC
TTTGCAATATCTTTCGGGAGACACGGGAGGTTGATGCATCACAGGAAGCC
ATCCGGATCTTATACCCGCGGGTCATGAACCTGCGACCGAAGATCCGTGA
AGCAGCTGAGGCGGAAGATCCGGAGAAATTCAGGGGGTACACTCGAATAT
TTGCAGAGGCTGGAGAAGCTTGGGTGGTTCTAATTGCACGCATGCCGATG
GACTTCCGTGAATTGGTGTCAGCAATTGCTGAATGTGCTGCTCTGGACGC
TGAACGCGATGTTATTTCACTAACCTTTAACTTCTGGTACGAGCTCAAGA
ACTATCTGGTGCTAGAAAAGTACATCGAGGCCAGGGTGAAGATAGCTGAT
ATCTATTCGCAACTGGTTGATATCATGATTCGGCATCTTCATTACCCCGA
AGGAAGTGAAGCAGACCCGTTCGACGGAGATAGGGAAACAGAAGAAAAGT
TTAGGGAGTTTAGGCATTCCATGGGTGATGTTCTGAAGGATTGCTGCGAA
GTTATTGGCTCGGCAGCATGTTTAGGCAAGGCTTACTCTGAAATTCAGAC
CTGGATGCAGCGTTATGCCACCACCGCCCAGAAGCCTGTCAATGGTCAAG
TCGAGCACTGGCAGAGTTTGGAAGCACCCCTCTTCAGTTTGAGGGCGATG
GG

Sequences in the Contig:

SY0AAC18YO01FM1 SY0AAC22YM22FM1 SY0AAC28YA15FM1