Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3857
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00002897001 E-value : 6e-90
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3857
TTGGGGCTCATGCCCGATGCCCCACATTCACGACTCACAACAACGCAGAT
CCAACAGCAGCGTTATTCCTCACAACACGGTGTTCGGAGAAACCAATCTA
TCAGAAGAGAAGGGAGGAAAAAATGCGGACTAAATATCTCGAAGGTCTAG
CGTTATTCACATTTCCGTAATTTCTCCAAATGTACAGTACGTTCAGTGTT
TCTCCCCCTCAGCCACTCCAACAGCCAGCCAACTCTAGCCCACTATCATA
TACCTGATCTCATCCTACCTACCTCATGAACTTTTATTTTATTCCCCTCA
GGGAGCGAAAAAACATAAAAAAACCTTGTCGCAGCAACAAAAAGGAAACC
AGAGATGGAAAGGAAAAAACGCAAACTCAAGCTACTCACCATAAACGGGT
GTCAGAAAAGAAGAAAAAAATGTTTCATCCTTATATTTACCCCCCGGTCT
GAGCCAAGAAAAATTTATGAGAAAATCATTTTAATTTTAGTTCAGGAAAA
GGTCATTAAGGAGGAAAGAAAAAATGACAAAAAACACCCATCTCTAAAGG
TAGCAAACAAAATGAAGGTTGTTTTTTCACAAAAACAAACGATGGAAAAA
GAAAAATACCATGACAAATTTACTCAGAGTCGCTAACCTCTGCAACTTGA
ACAACAGGGCCCTTCTT

Sequences in the Contig:

SY0AAB20YG04FM1 SY0AAC18YN10FM1