Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3856
Length(NT) : 1388
Best Gene Model Blast : Link to GSTUMT00008015001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55066.1| Score: 609 E_value: 1e-125
KEGG Definition: succinyl-CoA synthetase, alpha subunit [EC:6.2.1.4]; K01899 succinate--CoA ligase (GDP-forming) alpha chain
Accession: aor:AO090009000644 Score: 609 E_value: 1e-125
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1255 Score: 731 E_value: 7e-78
PFAM Definition: CoA_binding, CoA binding domain. This domain has a Rossmann fold and is found in a number of proteins including succinyl CoA synthetases, malate and ATP-citrate ligases..
Pfam Number: pfam02629 Score: 280 E_value: 1e-25
Swissprot: Q9P727|SUCA_NEUCR
Gene Ontology:
GO:0004776 = Molecular function: succinate-CoA ligase (GDP-forming) activity

Sequence:
>Contig3856
TTGGAAAGGGATCACCAACCCCCCACTAACAACAACGTCCCCTCTCATTC
ATTTTTTCCCATTGCTCCCTCTTTCGCTTCGCCGACCGACAATGCTCGCT
CTGAAGCGTCTATCAACCTTCCGTGTAGCCTCCGTGACTCGCGGGTATTC
GACCTCCTCCGGCTACGCTTCTACTGCGAAGAATTTGCTCATTAACGCTG
ATACTAAGGTTATCTTTCAAGGATTTACCGGAAAACAGGGAACGTATGTT
TAATCCTCAGGTGGATACAATAGTGATGGTAGAAGTCATGCATGTGTGTG
TAAGAGGCGTAGTTAACGGAGGTGGGAGGTGGGGTGTTTTTAGGTTCCAT
GCGCAACAGGCGATTGAGTATGGTACGAATGTTGTTGGCGGGATTAGTCC
GAGGAAGGCCGGAAGCCAGCATTTGGATCGTCCGGTTTTTGGTACTGTGA
AGGATGCTATCAGCAAGGTCGGAGCCGATGCTAGCGCTATATTCGTTCCA
CCTCCGGTCGCGGCAAAGTCTATCGAGGAGGCCATCGAGGCGGAGATCAA
GCTTGTTGTTTGTATCACTGAGGGGATTCCTCAGAATGACATGGTCCGGG
TTGTGGATATGTTGAAGACGCAGAACAAGACCAGATTAGTGGGACCGAAC
TGCCCCGGAATCATTTCCCCAGGCCAGTGCAAGATTGGTATTATGCCGGG
TTTCATCCACAAGAGAGGCAGGATCGGTGTTGTCTCTAGATCTGGAACTC
TAACCTACGAGGCTGTAAACCAAACTACTCAGGTTGGACTTGGCCAAAGC
TTGTATCGGAGGTGATCCATTCTCCGGAACCTCTTTCACTGATGCCTTGA
GTGTTTTCTTGGGAGATGATGAAACCGATGGAATCATCATGATCGGTGAA
ATCGGAGGTTCCGCAGAAGAAGATGCTGCGGATTACCTGAAAGCCAACAA
CCCCAAAAACAAGCCCATCGTATCATTCATCGCCGGCATCTCCGCGCCAC
CAGGGAGGCGGATGGGGCACGCCGGTGCCATCGTCAGCGGCGGCAAGGGA
GGGGCCGAGTCTAAGATCTCGGCACTCGAGGATGCTGGCGCCATTGTCGA
GCGTAGCCCCGCCTCCCTCGGAAAGAGTCTTTACGAACAATTTGTAAAGC
GTGACTTGTTGTGAGCTGGAATTGGAGATTGGGTGGTAATTCTTATGTTA
TAGAGATGTTTGGGATTTGGAAGGACGGGATAGGGGCCTTCCTGTAACTT
AGCGGTAACAAAATACACCTGTTCTTCTGGGGTGATCTGAGTGATGGTCA
TGAGATGTCACTCGGAGTTTTATTGGGTTTTGGTTCCTTTCCGTATGGTA
ACTGGTTTCTTTCACTACTTGGCTTTTCTTCGCTACTA

Sequences in the Contig:

SY0AAC18YN01FM1 SY0AAD20YI23FM1 SY0AAD52YB05FM1
SY0AAD57YE09FM1