Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3855
Length(NT) : 1432
Best Gene Model Blast : Link to GSTUMT00011070001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein FG06741.1
Accession: ref|XP_386917.1| Score: 332 E_value: 6e-29
KEGG Definition: hypothetical protein
Accession: fgr:FG06741.1 Score: 332 E_value: 3e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3855
TTGGGAAATATGCCACTCTTTAGATCTGGTGTTTGGCTTCTTGGGGCATT
ACTGTCCTTTACACCGGTAGTGCACGGCAGAGATGCTAATCCTACCGAAG
ATTTTTGCTCCTTGAGTGCGCATATGATGGCCCAGAAAGATGATATGCTC
TATATTGCTGGAGGATGGATGTTGTATCCTTCGCCATACACGGGTTACAA
TGGCCCAAATACGGTGCTTCGATCATTGAATGTGTCCAAGAGTTTCCAAA
CTTCTCTTGACAGTACCAATTATATTCGAACGGAAGAAGTTCCGGGCACG
ATACCTGGTGTACAAGATGCCGCGTTCTTCCCTACGGAATCCGGGTTTGA
CCTTAGTTTCGGAAGGTGGTGGCCATACAACAGTACTCTTTTTGGAACTA
GGGAAGGTCCGGTGGAGGATAAGAAATGGCAATACGAGATTGCGACTCAG
CGGTGGACGGATACGGGAATAACGCTAAAGAATTGGTTCTATGCGGACTC
TCTAATGAGGGTATCCAGCTCTATGACAGCATGGGTCCCGTCATTGAAGA
AGGGTTTTCTTTTCGGTGGTACCTTCGTCTCGGAAAACGGAACGTCGCTC
AAGGTGACGGAGTTTGAGGAGCACAACGGCCTAATCACTTACGATCAGAC
TACCAACGCATGGACAAACGAAAGCACGCCGTTGGGAGGAATAGCTGAGG
GAGGCTTGGTGCATATTACAACAGCGACGGATGAGGTCTTGATCCAGCTG
GGTGGAAGGTCTGAGTGGGCTACCCGCATGAGAGTATTCTCCGAGATCAA
CATTTATAGCACGAACCGATCAAAATGGTACACCCAACATCTACCATCCG
ATGCTGCGGTGCCGACTCCTCGATTCGCGTTCTGCACCGCTCTCAAGTCA
GCTTCGGATGGTTCCAGCCATCACATCTACATTATGGGGGGCCTTGAAGC
CAGCACTTCGGTAAATGCCAAGGGAGGCCCAACCACTACATCCGTCTGGG
TTCTTTCGATCCCGAGCTTTGAGTGGGTCCAATTGCCGTTCAAGTCAAAG
TCCACGGCGGCGGACCCGAAAGGGAGGATCTCACCAAAATGTCAGGCCAT
TGGAGAGCATTACATCTTCTACTATGGTGGGAGGAACGTCCCGAGTTTCT
ACACCGTCCCCACCTGCGACAAGAAGGCAAATGCTGGGTTCCTGTTCGAC
GTCAACACATTGACATGGACGGACGAGTATACGCCGAATGAGGGAACGTA
CGAAATTTCCCCGAGCATTACCGGGGTTATTGGCGGGGACAAAAAGGGAG
GCTCAACCAAGAAGGCGCCAGCCAAGGGCTGGAGCGACCCGGATCTTGAA
ACCATTATGACACTGAAGACCACCACGGCCGGGAACTCGAACATTGGGAC
GAACAACAACAGCAACTCCAACAACACGGGCA

Sequences in the Contig:

SY0AAA47YJ24FM1 SY0AAC18YM18FM1 SY0AAC26YO24FM1
SY0AAC50YO12FM1 SY0AAC5YI16FM1 SY0AAC62YJ04FM1
SY0AAD1YF01FM1