Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3854
Length(NT) : 1140
Best Gene Model Blast : Link to GSTUMT00004507001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_00107
Accession: ref|XP_001598021.1| Score: 362 E_value: 7e-45
KEGG Definition: protein required for meiosis
Accession: aor:AO090011000592 Score: 321 E_value: 2e-42
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG3694 Score: 133 E_value: 1e-08
PFAM Definition: No Hit Found
Swissprot: Q09743|STE16_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0031932 = Cellular component: TORC2 complex
GO:0006995 = Biological process: cellular response to nitrogen starvation
GO:0000747 = Biological process: conjugation with cellular fusion
GO:0031929 = Biological process: TOR signaling pathway

Sequence:
>Contig3854
TTGGGGATGCAGAGATCGTTACCAAAGTCAAGGGATGCCTTTGGGCGGTT
GGAAATATTGGTTCAATGCCTTTCGGGGCGCCATTCTTGGAAGAAGCCGA
CATAGTGGAGTCTATTGTCAAGATCGCGGAGGAATCCCAGGTATTGACGC
TTAAGGGTACAGCGTTTTTTGTTCTTGGCTTGATATCCAGGACTATGCAG
GGTCTAGAGATCCTTCTTGAGTACGGATGGGATGGCACAACGTCCACCAT
GGGAGAATCGCTAGGGTTCTGTATCCCTTTGAAGCTTGGACGTCTTCTTT
CCGTAAGTTCCGTATTTGCAGAAACCAAAGCCTTAGCGAACTACTACCAT
AGTATCGCCACACGCACACAGGAGTCAGTGAGTAGTGATATAATATAACT
AACTTCTTTCATTTCATTTTATCCTACACACAGGTAGCACCCTGGTACCA
TACAGGAGACGAAACGAACCAGATAAATAGACCATCACCACTTTCCTCGG
TGATCGGAGATGACCCGGTGGATGCAAAGATATTGACGGCAATCGCGAAC
CTAAACAACCATATCCTCGAGAGCGGTTCCACCAAGGAATTGAATCGGCT
CAAAGCTAGTCACGTGATGCAATTCCAATCCCCAGATCTCTTCCGACGAG
TGATGACGCTTATTGAGTCGTTCCGATATCGGCAGCACGTTCGGCGGTAT
ATACTTGACCTCTTTGAGAAGTCAGTGGTGGAGAGGGTTTTTGCAGAGGG
CCGAGCTGACCCGGAGGTTGAATCTCCTGATACTCCAGAGGGATTCAGAT
AATGAGGCTGCCAGTGGCCGGAGCGGGGGAGGGGGAAGCGGAATCGGAGT
TCGGAAGATATCATATGCGGCAGCGAGGTGGGAAAGAAATTTCTATATAT
TTCTTCCCTTTTCCTTTTTCTTCGTGATAATTTGCATTGTCTTGCCTTTT
GCTGACCTCTGTCTCTCTCTCTCTCTCTCTCTGACTGCCCAATTGGGTGC
GTTCCATTCCGGTCTCAATTCCATCCCGTTTCTCCTCTTCTGGATGGTCA
CTTTTTTCTTTCTCTTCCCATTTTTTCCATTTCCTCTTGATGACATCTGA
TCTGTCCATGTACATTAAATTACGAGCCCGTTCATCTTTT

Sequences in the Contig:

SY0AAC18YM07FM1 SY0AAC55YM02FM3