Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3853
Length(NT) : 881
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein FG07023.1
Accession: ref|XP_387199.1| Score: 409 E_value: 4e-38
KEGG Definition: hypothetical protein
Accession: fgr:FG07023.1 Score: 409 E_value: 2e-38
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0629 Score: 227 E_value: 1e-19
PFAM Definition: Pyridoxal_deC, Pyridoxal-dependent decarboxylase conserved domain..
Pfam Number: pfam00282 Score: 147 E_value: 2e-10
Swissprot: Q9Y600|CSAD_HUMAN
Gene Ontology:
GO:0004782 = Molecular function: sulfinoalanine decarboxylase activity

Sequence:
>Contig3853
AGTTTCTTGGTAACGGGTGATACGAGAAAGTTTTCGAAGGCCACGAGTTT
GAAGGCGGGATATTTGTTCCACGGAGACGAGGATGAGGAGGAAGTGTTTG
ATATGGCCCAGATGACGATGGGATGCGGGAGACGTGCGGATTCACTGAAG
ATGGCGTTAGGTTGGATATATTATGGGAAGGAGGGATATGAAGAAAGAAT
AAACCACGCCTTCGAAACAGCATCCTACTTCACCACCAAGCTGTCCCAAA
ACACAAACTTCTACCTCCTCTCATCCAACCCGCCACCATGTCTCCAAGTT
TGCTTTTTCTACACCCCCGAAGGAGCGCTCTCGGCCAATGCTAGAAAGAA
TACCACCACGACCCGAGCCATCGCAGCGAAACTCATCGTGAAGGGGTTCA
TGATTGACTACTCCCCCCATCCAATTCACGGCGAGTTTTTCAGAGCCGTT
GTGAACGCTTCCACAAGTAGAGATACAGTTGACCGATTGATTAATACCAT
CGAAGAGCACGTCATCCTTGAGAACTAAGCTCCGATAGCAGTATTAGTAG
TGTGGTCACACGGCTATCGGGACATCCCCAGCTCCGGTATATGCACAATT
GTACAAGTAGGGACCAAAAACTAGAACCAGAATAGGAACAGAAGAGATTT
TTTACAGCTCTTTGACCCCCATAGTCCAGTACTGAATACGGTACCTTTTT
AGCAACAGAAGCTATAAGCACTACCGGGAATGGTACTACCGATACCGATC
CACCGGAGGATCGAAGATTCCCGGGTTTATATTCATCTTTTCTCCACTTG
CTGCTCCAGGTTGAGTTGATTCGATTACCGTATCCTTTAGCCTATTATCA
CCAATACCTTCTCCTCACCGTCCCCCTCCTC

Sequences in the Contig:

SY0AAC18YL07FM1 SY0AAC39YO13FM1 SY0AAC40YJ12FM1
SY0AAC41YJ12FM1 SY0AAC44YK12FM1