Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3852
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00001755001 E-value : 9e-64
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_13230
Accession: ref|XP_001585714.1| Score: 251 E_value: 3e-20
KEGG Definition: septin AspB
Accession: afm:AFUA_7G05370 Score: 228 E_value: 8e-18
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2655 Score: 149 E_value: 7e-11
PFAM Definition: No Hit Found
Swissprot: O36023|SPN1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0031105 = Cellular component: septin complex
GO:0005940 = Cellular component: septin ring
GO:0005515 = Molecular function: protein binding
GO:0000920 = Biological process: cell separation during cytokinesis
GO:0008104 = Biological process: protein localization

Sequence:
>Contig3852
TTGGCCTTTCCTCCACCTTCACCTTCCAACACAACCCATACCACCCCCAT
TCATCCACCTTCATCCAGCGCTTCGGGTTGTTTGTGCTGCCGGTGCTGCT
TCCCAACCGTTACTTCCCTTTCCCTCCCGTCTTCATCCGTCGAGGGTTCT
ATATTTCATTCTCTCGTTGGTTGAAGGGATATAGCTCCTTCATTTTATTG
CTTTCTACTGCAATTGTCGTGTTTACATTCACCCATCCCAATCTTCTTCA
CACCCCTTTCTTTATAGCTTTGCTTTAAGAAACATATTTGAAGGAAGTCA
AAAAAACTTCCCACAATTTAGCTGTATCCTCTGTCGCCGCTATGTCCACT
CCTTCTTTGCCAGATTCTCCTCAGCTAGAATCCAGATTTTCTCCATTGTC
ATCCCCTCTTGTGCCCGTCGCTGCTCAGTCTACCAATCCTAAGCTTGCCG
CTGCTCAGGCAGCTTCTGCTGATGCTAAGAACATCGTGAGACGGAAGTTG
ACTGGGTATGTTGGGTTCGCCAATTTGCCTAATCAATGGCATAGGAAGAG
TGTCCGAAAAGGATTTAACTTTAATGTTATGGTTGTCGGTGAATCTGGGC
T

Sequences in the Contig:

SY0AAC18YL03FM1 SY0AAC38YE11FM1 SY0AAC54YF24FM1