Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3851
Length(NT) : 957
Best Gene Model Blast : Link to GSTUMT00000247001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001546716.1| Score: 614 E_value: 8e-79
KEGG Definition: glutaryl-CoA dehydrogenase, putative [EC:1.3.99.7]; K00252 glutaryl-CoA dehydrogenase
Accession: afm:AFUA_3G06040 Score: 576 E_value: 3e-75
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0138 Score: 527 E_value: 2e-54
PFAM Definition: Acyl-CoA_dh_N, Acyl-CoA dehydrogenase, N-terminal domain. The N-terminal domain of Acyl-CoA dehydrogenase is an all-alpha domain..
Pfam Number: pfam02771 Score: 187 E_value: 5e-15
Swissprot: Q2KHZ9|GCDH_BOVIN
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004361 = Molecular function: glutaryl-CoA dehydrogenase activity

Sequence:
>Contig3851
TTGGGCTGTGTACCTGCTTGCCAAAAGGTTTACAATGTACCGTATTTTCC
GAGAAATACGCTTCTACCGAAACACTTGTACCTTCCATCTCCCGAGAACT
TCGAACCTCCCTACTGGGGTCCCCTCCACCACCAAGTCTCCTACCGGTAG
GTACACCTCACTAGCTAAACCCAGCTCAATACTCCCTACCCGAGTATACA
ATTACCAAAAAAAAATGCTTCGCACAATCCTCCGGCCAGCCCATCAGGGT
GCACTTCACATAACTACCAAAATAACAACAGCAGCCGCCACAATTCGAAA
AGCCCACAGCACAACATTTGACTGGCAGGACCCTCTCCTACTCACTTCCG
CCCTGACAGATGATGAAGTCACCATTTCGAATATGGCGCGGGAGTATTGT
CAGGAGAAGCTTTTGCCTCGGGTTTTACAGGCGTACCGTGATGAGCATTA
CGACAGGAGGATTTTGGTTGAGATGGGGGAGTTGGGACTATTGGGGGCTA
CGATTAATGGGTACGGATGTGCAGGTGTGGGGAATGTTGCCGCAGGGTTG
GTTACTAGAGAAGTGGAGAGGGTAGATAGTGGATACCGCAGTGGAATGAG
TGTTCAGAGCTCACTCGTCATGGGAGGCATCGACGAGTTCGGGACGCAGG
AGCAGAAGGAGCGATTCCTGCCGGGTATGGCAAAGGGAAAGATTATTGGA
GCCTTTGGCCTGACAGAACCAAATCATGGTTCCGATCCTGGGTCGTAATT
TACCATTCCAATCCCTCGACGAGAAGTATAGTTTGCTAATTGAAAGTTAG
CATGGAAACCGTTGCCCGACCACATCCCACAAAGAAGGGAGTCTGCCTCC
TTTTCGGGTCGAAAACCTGGATCACAAATTCTCCAATCGCAGACGTTCTC
ATGGTCTGGGCCAAACTCGACTGTAAGATCCGTGGCTTTCTCGTGGAGAG
AGCTACC

Sequences in the Contig:

SY0AAC18YL02FM1 SY0AAD30YB10FM1