Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3850
Length(NT) : 1033
Best Gene Model Blast : Link to GSTUMT00002673001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: putative aspartate-tRNA synthetase
Accession: ref|XP_713293.1| Score: 968 E_value: 1e-103
KEGG Definition: putative aspartate-tRNA synthetase
Accession: cal:CaO19.9945 Score: 968 E_value: 1e-103
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0556 Score: 1109 E_value: 1e-122
PFAM Definition: tRNA-synt_2, tRNA synthetases class II (D, K and N)..
Pfam Number: pfam00152 Score: 528 E_value: 2e-54
Swissprot: P04802|SYDC_YEAST
Gene Ontology:
GO:0004815 = Molecular function: aspartate-tRNA ligase activity
GO:0042802 = Molecular function: identical protein binding
GO:0003723 = Molecular function: RNA binding

Sequence:
>Contig3850
TTGGAGCGAGCGAGCCTCTTTCGCTTCCTCAACTTTCCCAAACATTCGCA
AAATGTCTTCCACTGAGCCTCCCACTGACCAGATCCTTGCTGAAGGTGAA
CCAAGTGTAAACGTTCCCATAGGACCGGACGGTAAGCCACTCTCCAAGTC
CGCCATCAAGAAGCTCCAGAAGGAGAGGGAGAAAGCAGAGAAAGCCGCCA
AACGCGCCGCCCTGGAAGCAGAGCAGAAGGCCGCCCGCGAAGCCGCAAAC
CTCGACCACTGTTTCACTCGCTACCAGGTTGGACAACAGGGTCATCGATC
TGAGAATTCTAAGCAATCAAGCCATCTTCAACATCTCTTCGGCTGTCTGC
ACCCTCTTCAAGGAATACCTACTCAAGCACAACTTTGTCGAGGTTCACAC
GCCCAAATTAATCGCGGCTGCTAGTGAGGGCGGCTCCAACGTGTTCAAAG
TTCACTACTTCAATAGGGATGCCTATCTTGCCCAGAGCCCGCAGCTATAC
AAGCAGATGCTTATCGCCGCCGACTTTGAGCGTGTGTTTGAGATAGCTCC
CGTCTTCCGAGCTGAAAATTCCCAGACACATAGACACATGACTGAGTTTA
CCGGATTGGATCTAGAAATGGCGTTTGAGGAGCATTACCATGAGGTGGTC
GAGGTGCTCGAAGGACTATTCGTCTACATCTTTGCAGGCTTGCAGGAACG
CTTTGCGAAGGAGATAGCTATCGTCCGAGCTCAATACCCTGTCGAGGAGT
TCAAGGTTCCAAAGGACGGGAAAGTTCTGCGCCTGACCTTCAAGCAAGGG
ATAGCAATGCTCCGCGAGGCGGGGCATGAAGTTCCAGACCTAGAAGATCT
TAGCACGGAAATGGAACGCACTCTCGGTAGACTGGTCGCAGAGAAGTATG
GCGAAGACTTTTACATCCTGGACAAATTCCCTCTAGCTGTTAGACCATTC
TATACCATGCCTGATCCGGAAGACCCTCAATACTCCAACTCCTACGACTT
TTTCATGCGAGGCGAAGAGATCCTCTCTGGCGC

Sequences in the Contig:

SY0AAA14YA21FM1 SY0AAC18YK08FM1