Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig385
Length(NT) : 693
Best Gene Model Blast : Link to GSTUMT00002961001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_13864
Accession: ref|XP_001547702.1| Score: 269 E_value: 4e-22
KEGG Definition: hypothetical protein [EC:3.1.-.-]; K01175
Accession: dha:DEHA0G10461g Score: 263 E_value: 1e-21
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2249 Score: 265 E_value: 3e-24
PFAM Definition: Exonuc_X-T, Exonuclease. This family includes a variety of exonuclease proteins, such as ribonuclease T and the epsilon subunit of DNA polymerase III..
Pfam Number: pfam00929 Score: 150 E_value: 7e-11
Swissprot: Q6BIK6|REXO4_DEBHA

Sequence:
>Contig385
TTGGCTTCTCACACATCTCCGAACCACAAAGAGGCATACCATTTAATCAC
CGACTATGGCAACTACTGCGCTTTCAAGAAACTGGAAGCAGCTCCAAGAG
ACACTGAAAAAATCCTCCTCCACCACTCCCACCAATTCTTCAAAGCGCAA
GTCTTCATCGATCGAAAGCCCCACCAGCAGCAGCAGCTCTACAATTACAA
GGGCAAAAAAGGCAAAGCGAGCAAGAACCCCAAGCAGCACTGCCGCCAAC
CCCGCCAACCCACCCTTGATACCACGAGCTTCCAAACCAACCCCAACCTC
AAAAGTATTGAAGATGTCCACTGCCGCCCCAAAACCAACCTCCTCGGCGC
TGGCGCTCTGGGCGGAAGATAATGACATCTCCCCTGCGGATCTGCAAAAA
GCATACAACCTACCATTGACCAGCACCACCCTTCCACCCCCCACCGGTTC
GGCCATAGAGCCCGAGGCGTCGGGGTCGCCCTCGGCAACCGAACCCAAAA
AATACATCTCACTCGATTGCGAAATGGTCGGCGTGGGTGGGCCTACGAAC
GAGCGCTCCGCGCTCGCCAGAGTCTCGATAGTCAACTACCATGGGCATAT
AATCCTAGATACGTTCGTGCGGCCGAAGGAGAGGGTTACGGACTGGAGGA
GTTGGGTTAGTGGTGTTACGCCTGCGCATATGATTCACGCGAG

Sequences in the Contig:

SY0AAA22YI11FM1 SY0AAA31YO20FM1 SY0AAD29YA19FM1
SY0AAD8YN01FM1