Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3849
Length(NT) : 727
Best Gene Model Blast : Link to GSTUMT00000712001 E-value : 2e-46
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CC1G_03881
Accession: gb|EAU88209.1| Score: 147 E_value: 6e-08
KEGG Definition: hypothetical protein
Accession: uma:UM02665.1 Score: 139 E_value: 3e-07
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1770 Score: 166 E_value: 9e-13
PFAM Definition: No Hit Found
Swissprot: P32911|SUI1_YEAST
Gene Ontology:
GO:0043614 = Cellular component: multi-eIF complex
GO:0003743 = Molecular function: translation initiation factor activity
GO:0006413 = Biological process: translational initiation

Sequence:
>Contig3849
TTGGCCCTTCGCATTCCCGTCCAACACACAAGCTATCACCGGCACAACAC
TACTACATTTCAAGTCCAAACCACTGCTCCGAAGCACCCAGAAACAGCTT
TCCCGCATACCCAACCCCCCTCGAAGTCTGTTTATGTCCATCGAAAATCT
CAAGGTTAATGGTGAGTCTTTTTTCTTTCTCGAGTTTTTCGCCACATCAG
TGCTTTCGCCTGGAGGCACAACTCCTCTCAGATTCCAGCTTAATCCGATA
TCATTGGTTGGCCTTGTTCGCCGCCTTACTGCTGGATGCTTCTCGATCGC
TTAAGCTGTCGTTTTTGAATGCTAACACCTTCCTAGATCCTTTCGCCGAC
GACGTTGGTGATACTCAGCCCAAGAATTACGTCCATATTCGTATCCAACG
TGAGTACCTTTTGAGTTTTTTTTTGTGAGAAAATTAGTTGCACTTGGTTC
TGCACATTTTTACTTACTTGTTTCTCTCAGAGCGCAACGGTCGCAAGACC
TTGACGACTGTCCAGGGGTTGTCTAAAGAATACAGTCCTAAAGCTCTTTT
GAAAGCTTTCAAAAAGGAATATGGTAATTATCCCCCTTCCCCACCATTCT
GCTCGATTCGGGGGCTCTGCCCGTCTGTCTTCCATATCGTTTAGGCAGGG
CATCGATCTTGCCCCTTGATTGTTTTGAGATAACGGAGGCGCTGACCTTG
TGTTACCTCCATCGTTGCAGCTTGCAA

Sequences in the Contig:

SY0AAC18YJ24FM1 SY0AAC45YC08FM1 SY0AAD53YC10FM1