Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3848
Length(NT) : 831
Best Gene Model Blast : Link to GSTUMT00009168001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: PHD finger containing protein Phf2
Accession: ref|NP_593209.1| Score: 354 E_value: 8e-32
KEGG Definition: hypothetical protein
Accession: spo:SPAC30D11.08c Score: 354 E_value: 4e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4323 Score: 261 E_value: 1e-23
PFAM Definition: PHD, PHD-finger. PHD folds into an interleaved type of Zn-finger chelating 2 Zn ions in a similar manner to that of the RING and FYVE domains. Several PHD fingers have been identified as binding modules of methylated histone H3..
Pfam Number: pfam00628 Score: 150 E_value: 9e-11
Swissprot: Q09908|YAJ8_SCHPO
Gene Ontology:
GO:0033193 = Cellular component: Lsd1/2 complex
GO:0005634 = Cellular component: nucleus
GO:0033169 = Biological process: histone H3-K9 demethylation
GO:0009408 = Biological process: response to heat

Sequence:
>Contig3848
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGACCAAACCACCAAGCCTG
CCGTGCACCTCAAAACTCGAAACTCTTACCCTACCGGAAGTCCTTACTTC
AATCCCAGACCCGTCGTCCCAATTCCTCGCCGCATGACCGAGTCACAAAC
CATTTCGCCAGTAACCCCCCAACACGACGGGAACACAGCAGAGCCGATGG
ACTCTACAATTGACACCGATATGGTTTTACGGCAGAACTTAGAGCATTGG
CAGCAAATGGCCCCACCACCCCCACCTCCTCCTCCGGGACTACAGACACC
TATGGGAATCTCGGTAGCTTCCGGGTCCTTAGACGCACAATTAGCGGAAA
GTCAATCGCCGGAACTGCTCACACCGAAAAACGCTCAGGCGCCAAAAGGA
GGAGCAAGGGCTAGAGCTAGAGGTGGCTCTGGGAGGGGCACCCGGCGTAG
GAAGACTGGCAACGTCCCCGTTAAGGATGAGAGTGATGGTGCGTCATCGG
AAGAGTTTACAATGGAAGGCGTCAAGACAAAGTCTGGGAGAAAGGTACAT
AGGCCAGCGCACTTTAATCCCGCGCAGAAGCAACCGTCCCGACGCCGCGG
GCCGTACCGTCGCATTCACGATGCACGAATATGCAAAATCTGCCAGCGTG
GCCATTCACCGCAATCTAACATGATTGTCTTCTGCGATGGGTGTAACACT
CCATACCACCAGCTCTGTCACGACCCGCCAATCGACGACCTGGTGATAGC
TGTTGCTGAGGCGGAGTGGTTTTGCACGAGTTGTAGTAAAAAGCGAGAGG
AGCGACCCTTATCCACCGGCCTTAGTGGGCA

Sequences in the Contig:

SY0AAC18YJ14FM1 SY0AAC58YA22FM1 SY0AAD9YB11FM1