Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3847
Length(NT) : 2340
Best Gene Model Blast : Link to GSTUMT00010768001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: hypothetical protein CIMG_00294
Accession: ref|XP_001246523.1| Score: 1303 E_value: 1e-141
KEGG Definition: hypothetical protein
Accession: yli:YALI0E10813g Score: 1215 E_value: 1e-131
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG0036 Score: 1070 E_value: 1e-117
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 231 E_value: 1e-19
Swissprot: P48233|CMC1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005509 = Molecular function: calcium ion binding

Sequence:
>Contig3847
TTGGCTCTTCGTAGAAGTTTCACGATAATTTAACGGTAACCGCAATAACT
TACAGCCCCTCATTACTAGACCGGATAAGAAAGGAATAAAGGAGAGGAAG
AAAAAAACGCTCCATACATGAACGAGCGAGAGAGCCAAAAGGCTCGCGAT
GAGCGCTTACTGAAGCTCTTCAAGAGCCTGGATACACGCAGCGAGGGTCA
TTTAGACCTAGAGGGATTGAGGCGGGGTCTCAAGAGGATCAACCATCCTC
TGAAGGACGCGGAACACCTATTACACGATATCCTGGAAGCCGTCGATACA
TCTAAGGACGGCCTCATTCAGTATTCAGAATTCAAGCACTTCTTTGAGAG
TGCTGATCGGGAATTATGGCACATCTTCACTTCTGTCGACCTGGATAGGA
ATGGAAATATTGATAAAGCAGAACTACGAATCGCGCTTAGCCGTGCCGGC
CTAGTGGTAGATACAAAACGGCTGCAGGAGTTCTTTGATTCGATGGACAG
GAATAACGACGGTGTGATATGTTATGAGGAATGGAGAGATTTCCTCATGT
TCATGCCACATGAGGCCTCCTTAAAAACGATTTACTCCTACTACCTTTCC
ACCGTGAACGTTAACCCGGAAGGTGATGTGAGTCTTAGTGATGAGATAAA
TCACTTAGGACTAGGTAAATCCGGTTTCGATTCTTCCGATCTTACCCTCA
ATATCTCAGGCTACTTTCTTGCAGGCGGTATTGCAGGCGCAATTTCGAGA
ACTGCCACGGCGCCATTTGATCGTATAAAGGTTTACTTGATTGCGCAGAC
TGGCAATTCAACAGCGAAGAAAGCGATCGAGGCTGTGACGCAAGGTGAAG
CTGTCCAGGCTGCAAAAAAAGCTGCAGGACCAATCAAGGATTCTATCCGG
GCTTTGTGGAGAGCGGGCGGAGTTAGGTCCTTCTTTGCGGGCAACGGATT
GAACGTTGTAAAGATCCTGCCCGAGTCTGCAATCAAGTTTGGTTCGTTTG
AGGCTGCGAAACGAGCACTCAGTAGACTCGAGGGAACCAATGATGCATCA
AATATATCACCAATTTCTAGATTCTTGGCCGGCGGTATCGGTGGTGTTGT
CTCTCAATTTTCCATATATCCCATTGACACTCTGAAATTCCGAATGCAAT
GTGAATTGGTTGAAAATGGATCTACCGGGAATAAGCTTATTCTTGAGACA
TTCCGAAAGACCTGGAGTAACGGCGGACCTCAAGCATTTTACAAGGGCCT
TCCACTTGCTTTAATCGGGATATTCCCTTACTCGGCCATTGATCTGGGCA
CATTCGAGTATATGAAGAGGTCATACACGGCACGAAAAGCCAAAAAGTTA
AAATGCGACGAGAAAGACGTGGAGGTGCCGAATTGGGTGGTTCTAGGAAT
CGGTGCTACCAGTGGTAGCGTGGGGGCTACTATGGTATATCCCATTAATG
TGTTAAGGACGAGACTGCAAGCGCAGGGGACAGCGCAACACCCACAGACG
TACACCGGTATGTGGGACGTTGCGGTAAAGACATATAGCGCGGAGGGCTT
CCGGGGGATGTTCAGGGGTCTCACTCCGAATTTGCTGAAAGTCGTACCTG
CAGTTTCAATTTCGTACCTTGTTTACGAAAACTCGAAAAAGACCATGGGT
TTGGGATAGGGATCTGCGATACGGTACATAGATGTTTGTGATCTCCTTCG
ATATCAGTCGCAGCGCACACATTATAGAGGCGTCACAGCCGGATGTTTTT
TTTCCCCCCTATTTCACAATTCGTTTTTTTCCATTTTCCTCAATTGGCCT
AGGGTTTTCAAGATAAACGGTGTTTTTATTTTTATTTCAATGCATATAAT
TTCTTTTCTTCATTGTTTGCACGGCCAACTCCATTGAATTTTGCTACTGC
TCAAGGGCCATTTTTGTTTTAGTGGTTGTCTCTTCTATTGAAAATTCAAG
GCAAATCGAGCCCGCTTCCACTGTTCTGATACCAGTAGATCTGGTCCCGC
CGCCATGCCTAATACCAGCCCCGTCACTACCCTGCCCTTCGGCGGGAACC
CAGACTTCAGCGTAATTTATCGGCGCTCCCGGCTCCTTCATCTCTACCGC
CACAGTGTACGTGCAGTCTTCAGGTAACCTACCCAGGTCTGGAGCAGCGA
TGGAAAGCTTCATCAGACAGGCCCTAAACTGTGCCTCCAACCCCGCAATC
GTAATTTCGTCCAATCTCTTCCTTTCCCCTCCTGATTCCCCTCCTCTCCC
TCCAACCTCTGCCAACTGCTGCAGGAGCAAATCATTATACCCACCCTCAA
ACGGAACATTCGGGAACACGCTAAGGTCGAAAACGTCCAA

Sequences in the Contig:

SY0AAA28YH04FM1 SY0AAA29YN23FM1 SY0AAA33YK15FM1
SY0AAA61YF10FM1 SY0AAA9YP01FM1 SY0AAB44YE13FM1
SY0AAB60YH04FM1 SY0AAC18YI22FM1 SY0AAC31YO19FM1
SY0AAC35YN22FM1 SY0AAC58YP11FM1 SY0AAD14YI12FM1
SY0AAD1YK06FM1 SY0AAD32YI21FM1 SY0AAD63YK12FM1