Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3846
Length(NT) : 799
Best Gene Model Blast : Link to GSTUMT00003735001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_14419
Accession: ref|XP_001584650.1| Score: 292 E_value: 1e-24
KEGG Definition: hypothetical protein
Accession: ang:An08g00580 Score: 244 E_value: 2e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3846
TTGGAGGCGGACCCCTGAAGAAGAAACCTCTTAGAGCTAAGGAGCCTGGT
ACCTTGGCCATCATGCCTAGACCACCGAAAATGGAAGTTACGGCCAAGAG
TGCGATTGAGGGTGAACTATACATTAATGAGATCGTAAAGATCGAGCTGG
CGGTTGAAAACGGTGAAGAAGAAGATGCTATAGTTGATATAGGCCTGCGG
ATTCTTGGATGGCCAGTGGATGACGATCTACCGTCAGTAACCTGGATATC
TGATGGAGTAGAAGAGCCAGCAACAGCATCTCTATACCCACTAGGCAAAC
TTTCTCCGTCCGCACCCCCAACAAAACGCACAATATGCTTCCCATCACCA
TCAATGCCTGCCGATTGTGCAATAGAGATAACGGTTCATTACCATCTAAT
CTCCGATCCAGATACCTACATTCATAAAAGTGTCATGACCGAGATGCCTA
TCATCAATCCATTTTCTACAACCTTTGACTTCTCCCCACGGGTCCATCCA
GATCCATGGCCAGACTACTTTTCCCTGGAAGAAGGCACCGGATGGGAGAA
TGGAAAGAGGGTACTCGGCATTATCCAGCAATGGTGTCTAACCGTTACGC
TATACACCACCGGAGGAGGCGTGGTGGTAGTTGAGAACTGGGAGCTTCCA
ATCCATGCTGTGGAAAGTGGCGGAGACGGCTCAGCTTGCCGAGTGATAAC
AGACGAAGACTCCAAAGAATCATTACGTATGACCTCCCCCTTCCTCCCCC
TCTTCTTTCACCTCAAATTTTACTTTCCATCAAATTCTAACGCAACCAA

Sequences in the Contig:

SY0AAA58YG09FM1 SY0AAC18YI14FM1